Rat SMTN(Smoothelin) ELISA Kit

Rat SMTN(Smoothelin) ELISA Package

Rat Smoothelin (SMTN) ELISA Kit
RD-SMTN-Ra-48Tests	Reddot Biotech	48 Tests	EUR 557

Rat Smoothelin (SMTN) ELISA Kit
RD-SMTN-Ra-96Tests	Reddot Biotech	96 Tests	EUR 775

Rat Smoothelin (SMTN) ELISA Kit
RDR-SMTN-Ra-48Tests	Reddot Biotech	48 Tests	EUR 583

Rat Smoothelin (SMTN) ELISA Kit
RDR-SMTN-Ra-96Tests	Reddot Biotech	96 Tests	EUR 811

Human Smoothelin (SMTN) ELISA Kit
DLR-SMTN-Hu-48T	DL Develop	48T	EUR 517
Should the Human Smoothelin (SMTN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Smoothelin (SMTN) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Smoothelin (SMTN) ELISA Kit
DLR-SMTN-Hu-96T	DL Develop	96T	EUR 673
Should the Human Smoothelin (SMTN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Smoothelin (SMTN) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Smoothelin (SMTN) ELISA Kit
RD-SMTN-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Smoothelin (SMTN) ELISA Kit
RD-SMTN-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Smoothelin (SMTN) ELISA Kit
RDR-SMTN-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Smoothelin (SMTN) ELISA Kit
RDR-SMTN-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Rat Smoothelin (SMTN) ELISA Kit
20-abx156101	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Rat Smoothelin (SMTN) ELISA Kit
SEC856Ra-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5124.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Smoothelin (SMTN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Smoothelin (SMTN) in Tissue homogenates, cell lysates and other biological fluids.

Rat Smoothelin (SMTN) ELISA Kit
SEC856Ra-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 509.64
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Smoothelin (SMTN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Smoothelin (SMTN) in Tissue homogenates, cell lysates and other biological fluids.

Rat Smoothelin (SMTN) ELISA Kit
SEC856Ra-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 685.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Smoothelin (SMTN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Smoothelin (SMTN) in Tissue homogenates, cell lysates and other biological fluids.

Rat Smoothelin (SMTN) ELISA Kit
SEC856Ra-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2783.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Smoothelin (SMTN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Smoothelin (SMTN) in Tissue homogenates, cell lysates and other biological fluids.

Rat Smoothelin (SMTN) ELISA Kit
4-SEC856Ra	Cloud-Clone	EUR 5175.00 EUR 2734.00 EUR 686.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Smoothelin elisa. Alternative names of the recognized antigen: SMSMO
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Smoothelin (SMTN) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

ELISA kit for Rat SMTN (Smoothelin)
ELK6982	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Smoothelin (SMTN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Smoothelin (SMTN Show more
Description: A sandwich ELISA kit for detection of Smoothelin from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Rat Smoothelin (SMTN) Protein
20-abx167608	Abbexa	EUR 690.00 EUR 286.00 EUR 2124.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Rat Smoothelin (SMTN) CLIA Kit
20-abx493941	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Mouse Smoothelin, Smtn ELISA KIT
ELI-19062m	Lifescience Market	96 Tests	EUR 865

Human Smoothelin, SMTN ELISA KIT
ELI-52975h	Lifescience Market	96 Tests	EUR 824

Human Smoothelin (SMTN) ELISA Kit
20-abx153124	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Smoothelin (SMTN) ELISA Kit
abx390587-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Smoothelin (SMTN) ELISA Kit
SEC856Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Smoothelin (SMTN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Smoothelin (SMTN) in Tissue homogenates, cell lysates and other biological fluids.

Human Smoothelin (SMTN) ELISA Kit
SEC856Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Smoothelin (SMTN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Smoothelin (SMTN) in Tissue homogenates, cell lysates and other biological fluids.

Human Smoothelin (SMTN) ELISA Kit
SEC856Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Smoothelin (SMTN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Smoothelin (SMTN) in Tissue homogenates, cell lysates and other biological fluids.

Human Smoothelin (SMTN) ELISA Kit
SEC856Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Smoothelin (SMTN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Smoothelin (SMTN) in Tissue homogenates, cell lysates and other biological fluids.

Human Smoothelin (SMTN) ELISA Kit
4-SEC856Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Smoothelin elisa. Alternative names of the recognized antigen: SMSMO
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Smoothelin (SMTN) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Smoothelin(SMTN)ELISA Kit
QY-E04585	Qayee Biotechnology	96T	EUR 361

Smoothelin (SMTN) Antibody
20-abx128197	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Smoothelin (SMTN) Antibody
20-abx130055	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Smoothelin (SMTN) Antibody
20-abx006625	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Smoothelin (SMTN) Antibody
20-abx174576	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Smoothelin (SMTN) Antibody
20-abx174577	Abbexa	EUR 913.00 EUR 467.00	1 mg 200 ug
Please enquire.

Recombinant Smoothelin (SMTN)
4-RPC856Hu01	Cloud-Clone	EUR 467.36 EUR 228.00 EUR 1477.60 EUR 559.20 EUR 1018.40 EUR 376.00 EUR 3544.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P53814 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 48.5kDa Isoelectric Point: Inquire
Description: Recombinant Human Smoothelin expressed in: E.coli

Recombinant Smoothelin (SMTN)
4-RPC856Ra01	Cloud-Clone	EUR 494.24 EUR 235.00 EUR 1578.40 EUR 592.80 EUR 1085.60 EUR 394.00 EUR 3796.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: D4ABA5 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 22.4kDa Isoelectric Point: Inquire
Description: Recombinant Rat Smoothelin expressed in: E.coli

Smoothelin (SMTN) Polyclonal Antibody (Rat)
4-PAC856Ra01	Cloud-Clone	EUR 259.00 EUR 2708.00 EUR 670.00 EUR 328.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SMTN (Gln748~Val911) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Smoothelin (SMTN)

ELISA kit for Human SMTN (Smoothelin)
ELK4065	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Smoothelin (SMTN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Smoothelin (SMTN Show more
Description: A sandwich ELISA kit for detection of Smoothelin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Smoothelin (SMTN) CLIA Kit
20-abx493940	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Smtn ELISA Kit| Mouse Smoothelin ELISA Kit
EF016229	Lifescience Market	96 Tests	EUR 689

Human Smoothelin (SMTN) Protein
20-abx166596	Abbexa	EUR 648.00 EUR 272.00 EUR 1998.00 EUR 773.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Anti-Smoothelin/SMTN Antibody
A04895	BosterBio	100ug/vial	EUR 294

Smoothelin (SMTN) Polyclonal Antibody (Rat), APC
4-PAC856Ra01-APC	Cloud-Clone	EUR 364.00 EUR 3545.00 EUR 980.00 EUR 467.00 EUR 227.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SMTN (Gln748~Val911) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Smoothelin (SMTN). This antibody is labeled with APC.

Smoothelin (SMTN) Polyclonal Antibody (Rat), Biotinylated
4-PAC856Ra01-Biotin	Cloud-Clone	EUR 325.00 EUR 2658.00 EUR 777.00 EUR 400.00 EUR 225.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SMTN (Gln748~Val911) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Smoothelin (SMTN). This antibody is labeled with Biotin.

Smoothelin (SMTN) Polyclonal Antibody (Rat), Cy3
4-PAC856Ra01-Cy3	Cloud-Clone	EUR 444.00 EUR 4685.00 EUR 1265.00 EUR 581.00 EUR 261.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SMTN (Gln748~Val911) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Smoothelin (SMTN). This antibody is labeled with Cy3.

Smoothelin (SMTN) Polyclonal Antibody (Rat), FITC
4-PAC856Ra01-FITC	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SMTN (Gln748~Val911) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Smoothelin (SMTN). This antibody is labeled with FITC.

Smoothelin (SMTN) Polyclonal Antibody (Rat), HRP
4-PAC856Ra01-HRP	Cloud-Clone	EUR 332.00 EUR 3089.00 EUR 866.00 EUR 421.00 EUR 213.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SMTN (Gln748~Val911) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Smoothelin (SMTN). This antibody is labeled with HRP.

Smoothelin (SMTN) Polyclonal Antibody (Rat), PE
4-PAC856Ra01-PE	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SMTN (Gln748~Val911) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Smoothelin (SMTN). This antibody is labeled with PE.

Smoothelin (SMTN) Polyclonal Antibody (Human)
4-PAC856Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SMTN (Gln742~Arg906) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Smoothelin (SMTN)

Smoothelin (SMTN) Polyclonal Antibody (Rat), APC-Cy7
4-PAC856Ra01-APC-Cy7	Cloud-Clone	EUR 608.00 EUR 6970.00 EUR 1840.00 EUR 814.00 EUR 335.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SMTN (Gln748~Val911) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Smoothelin (SMTN). This antibody is labeled with APC-Cy7.

Smoothelin (SMTN) Polyclonal Antibody (Human), APC
4-PAC856Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SMTN (Gln742~Arg906) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Smoothelin (SMTN). This antibody is labeled with APC.

Smoothelin (SMTN) Polyclonal Antibody (Human), Biotinylated
4-PAC856Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SMTN (Gln742~Arg906) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Smoothelin (SMTN). This antibody is labeled with Biotin.

Smoothelin (SMTN) Polyclonal Antibody (Human), Cy3
4-PAC856Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SMTN (Gln742~Arg906) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Smoothelin (SMTN). This antibody is labeled with Cy3.

Smoothelin (SMTN) Polyclonal Antibody (Human), FITC
4-PAC856Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SMTN (Gln742~Arg906) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Smoothelin (SMTN). This antibody is labeled with FITC.

Smoothelin (SMTN) Polyclonal Antibody (Human), HRP
4-PAC856Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SMTN (Gln742~Arg906) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Smoothelin (SMTN). This antibody is labeled with HRP.

Smoothelin (SMTN) Polyclonal Antibody (Human), PE
4-PAC856Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SMTN (Gln742~Arg906) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Smoothelin (SMTN). This antibody is labeled with PE.

Smoothelin (SMTN) Polyclonal Antibody (Human), APC-Cy7
4-PAC856Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SMTN (Gln742~Arg906) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Smoothelin (SMTN). This antibody is labeled with APC-Cy7.

SMTN ELISA Kit (Rat) (OKCD01249)
OKCD01249	Aviva Systems Biology	96 Wells	EUR 896
Description: Description of target: ;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.25 ng/mL

SMTN ELISA KIT|Human
EF005579	Lifescience Market	96 Tests	EUR 689

SMTN ELISA Kit (Human) (OKCD00885)
OKCD00885	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Structural protein of the cytoskeleton. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.112 ng/mL

Smoothelin Antibody
20-abx141519	Abbexa	EUR 370.00 EUR 606.00 EUR 300.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Smoothelin antibody
10R-8118	Fitzgerald	100 ug	EUR 467
Description: Mouse monoclonal Smoothelin antibody

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

SMTN siRNA
20-abx934461	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SMTN siRNA
20-abx934462	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Anti-Smoothelin antibody
STJ16100219	St John's Laboratory	100 µg	EUR 446

Anti-Smoothelin antibody
STJ180240	St John's Laboratory	0.1 ml	EUR 237

Smtn ORF Vector (Rat) (pORF)
ORF076722	ABM	1.0 ug DNA	EUR 506

SMTN cloning plasmid
CSB-CL021855HU-10ug	Cusabio	10ug	EUR 558
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2748 Sequence: atggcggacgaggccttagctgggctggatgagggagcccttcggaagctgctggaggtcacagcagatctggcagagcggcggcgcatccgctcagccatccgggaactgcagcggcaggagctggagcgcgaggaggaggccctggcatccaagcgtttccgtgccgagcggc Show more
Description: A cloning plasmid for the SMTN gene.

SMTN Rabbit pAb
A6745-100ul	Abclonal	100 ul	EUR 308

SMTN Rabbit pAb
A6745-200ul	Abclonal	200 ul	EUR 459

SMTN Rabbit pAb
A6745-20ul	Abclonal	20 ul	EUR 183

SMTN Rabbit pAb
A6745-50ul	Abclonal	50 ul	EUR 223

SMTN Polyclonal Antibody
30729-100ul	SAB	100ul	EUR 252

SMTN Polyclonal Antibody
30729-50ul	SAB	50ul	EUR 187

Anti-SMTN antibody
STJ28828	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a structural protein that is found exclusively in contractile smooth muscle cells. It associates with stress fibers and constitutes part of the cytoskeleton. This gene is localized to chromosome 22q12.3, distal to the TUPLE1 locus and outside the DiGeorge syndrome deletion. Alternative splicing of this gene results in multiple transcript variants encoding distinct isoforms.

Custom production of antibodies in 5 Rats using customer supplied antigen (std 63 days protocol)
RAT-5	Alpha Diagnostics	1	EUR 1138

Human Smoothelin-like protein 1 (SMTNL1) ELISA Kit
abx519955-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Mouse Smoothelin-like protein 1 (SMTNL1) ELISA Kit
abx519956-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Mouse Smoothelin- like protein 2, Smtnl2 ELISA KIT
ELI-19984m	Lifescience Market	96 Tests	EUR 865

Human Smoothelin- like protein 1, SMTNL1 ELISA KIT
ELI-07294h	Lifescience Market	96 Tests	EUR 824

Mouse Smoothelin- like protein 1, Smtnl1 ELISA KIT
ELI-07295m	Lifescience Market	96 Tests	EUR 865

Human Smoothelin- like protein 2, SMTNL2 ELISA KIT
ELI-30344h	Lifescience Market	96 Tests	EUR 824

Bovine Smoothelin- like protein 2, SMTNL2 ELISA KIT
ELI-39438b	Lifescience Market	96 Tests	EUR 928

Human Smoothelin-like protein 2 (SMTNL2) ELISA Kit
abx383323-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Smoothelin-like protein 2 (SMTNL2) ELISA Kit
abx390588-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Smtnl2 ELISA Kit| Mouse Smoothelin-like protein 2 ELISA Kit
EF016230	Lifescience Market	96 Tests	EUR 689

SMTNL2 ELISA Kit| Bovine Smoothelin-like protein 2 ELISA Kit
EF011910	Lifescience Market	96 Tests	EUR 689

Smtn sgRNA CRISPR Lentivector set (Rat)
K6621001	ABM	3 x 1.0 ug	EUR 339

Anti-Human Smoothelin antibody
STJ16100450	St John's Laboratory	1 mL	EUR 1396

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

SMTN Polyclonal Conjugated Antibody
C30729	SAB	100ul	EUR 397

Mouse SMTN shRNA Plasmid
20-abx973993	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human SMTN shRNA Plasmid
20-abx954419	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

pENTR223-SMTN-G1939C vector
PVT11820	Lifescience Market	2 ug	EUR 304

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

Smtn sgRNA CRISPR Lentivector (Rat) (Target 1)
K6621002	ABM	1.0 ug DNA	EUR 154

Smtn sgRNA CRISPR Lentivector (Rat) (Target 2)
K6621003	ABM	1.0 ug DNA	EUR 154

Smtn sgRNA CRISPR Lentivector (Rat) (Target 3)
K6621004	ABM	1.0 ug DNA	EUR 154

SMTN Protein Vector (Rat) (pPB-C-His)
PV306886	ABM	500 ng	EUR 1166

SMTN Protein Vector (Rat) (pPB-N-His)
PV306887	ABM	500 ng	EUR 1166

SMTN Protein Vector (Rat) (pPM-C-HA)
PV306888	ABM	500 ng	EUR 1166

SMTN Protein Vector (Rat) (pPM-C-His)
PV306889	ABM	500 ng	EUR 1166

Smoothelin-Like 1 (SMTNL1) Antibody
20-abx115625	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Smoothelin-Like 2 (SMTNL2) Antibody
20-abx115626	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Human Smoothelin-Like 1 Phospho-Ser301 (SMTNL1 pS301) ELISA Kit
abx259851-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Smtn ORF Vector (Mouse) (pORF)
ORF058025	ABM	1.0 ug DNA	EUR 506

Smtn ORF Vector (Mouse) (pORF)
ORF058026	ABM	1.0 ug DNA	EUR 506

SMTN ORF Vector (Human) (pORF)
ORF009816	ABM	1.0 ug DNA	EUR 95

SMTN Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV621127	ABM	1.0 ug DNA	EUR 1355

SMTN Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV621131	ABM	1.0 ug DNA	EUR 1355

SMTN Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV621132	ABM	1.0 ug DNA	EUR 1355

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
CAS9LIG-KIT	SBI	1 Kit	EUR 153
Category: Cas9

Smoothelin-Like Protein 2 (SMTNL2) Antibody
20-abx004012	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Smoothelin-Like Protein 2 (SMTNL2) Antibody
abx026407-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Smoothelin-Like Protein 2 (SMTNL2) Antibody
abx026407-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Smoothelin-Like Protein 2 (SMTNL2) Antibody
abx238044-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE620A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE622A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE624A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

SMTN sgRNA CRISPR Lentivector set (Human)
K2204001	ABM	3 x 1.0 ug	EUR 339

Smtn sgRNA CRISPR Lentivector set (Mouse)
K4611501	ABM	3 x 1.0 ug	EUR 339

vWF Acty. Kit
ABP-ACT-KIT	Abpcorp	12 x 8 microwells	EUR 428

vWF Ant. Kit
ABP-TOT-KIT	Abpcorp	12 x 8 microwells	EUR 394

Smtn sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6621005	ABM	3 x 1.0 ug	EUR 376

hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)
CAS620A-KIT	SBI	1 kit	EUR 2152
Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PrecisionX Multiplex gRNA Cloning Kit
CAS9-GRNA-KIT	SBI	10 rxn	EUR 445
Category: Cas9

SMTN sgRNA CRISPR Lentivector (Human) (Target 1)
K2204002	ABM	1.0 ug DNA	EUR 154

SMTN sgRNA CRISPR Lentivector (Human) (Target 2)
K2204003	ABM	1.0 ug DNA	EUR 154

SMTN sgRNA CRISPR Lentivector (Human) (Target 3)
K2204004	ABM	1.0 ug DNA	EUR 154

Smtn sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4611502	ABM	1.0 ug DNA	EUR 154

Smtn sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4611503	ABM	1.0 ug DNA	EUR 154

Smtn sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4611504	ABM	1.0 ug DNA	EUR 154

SMTN Protein Vector (Human) (pPB-C-His)
PV039261	ABM	500 ng	EUR 329

SMTN Protein Vector (Human) (pPB-N-His)
PV039262	ABM	500 ng	EUR 329

SMTN Protein Vector (Human) (pPM-C-HA)
PV039263	ABM	500 ng	EUR 329

SMTN Protein Vector (Human) (pPM-C-His)
PV039264	ABM	500 ng	EUR 329

SMTN Protein Vector (Mouse) (pPB-C-His)
PV232098	ABM	500 ng	EUR 1065

SMTN Protein Vector (Mouse) (pPB-N-His)
PV232099	ABM	500 ng	EUR 1065

SMTN Protein Vector (Mouse) (pPM-C-HA)
PV232100	ABM	500 ng	EUR 1065

SMTN Protein Vector (Mouse) (pPM-C-His)
PV232101	ABM	500 ng	EUR 1065

SMTN Protein Vector (Mouse) (pPB-C-His)
PV232102	ABM	500 ng	EUR 1065

SMTN Protein Vector (Mouse) (pPB-N-His)
PV232103	ABM	500 ng	EUR 1065

SMTN Protein Vector (Mouse) (pPM-C-HA)
PV232104	ABM	500 ng	EUR 1065

SMTN Protein Vector (Mouse) (pPM-C-His)
PV232105	ABM	500 ng	EUR 1065

Smtn 3'UTR GFP Stable Cell Line
TU169352	ABM	1.0 ml	Ask for price

SMTN 3'UTR Luciferase Stable Cell Line
TU023759	ABM	1.0 ml	EUR 1394

Smtn 3'UTR Luciferase Stable Cell Line
TU119352	ABM	1.0 ml	Ask for price

SMTN 3'UTR GFP Stable Cell Line
TU073759	ABM	1.0 ml	EUR 1394

Smtn 3'UTR Luciferase Stable Cell Line
TU220860	ABM	1.0 ml	Ask for price

Smtn 3'UTR GFP Stable Cell Line
TU270860	ABM	1.0 ml	Ask for price

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1	SBI	5 reactions	EUR 1152
Category: Stem Cell Products

Mouse Anti-Human Smoothelin monoclonal antibody, clone JID774
CABT-L2784-100uL500uL	Creative Diagnostics	100 uL, 500 uL	EUR 502

Smoothelin-Like 1 Phospho-Ser301 (SMTNL1 pS301) Antibody
abx238043-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Smtn sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6621006	ABM	1.0 ug DNA	EUR 167

Smtn sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6621007	ABM	1.0 ug DNA	EUR 167

Smtn sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6621008	ABM	1.0 ug DNA	EUR 167

SMTN Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV621128	ABM	1.0 ug DNA	EUR 1355

SMTN Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV621129	ABM	1.0 ug DNA	EUR 1413

SMTN Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV621130	ABM	1.0 ug DNA	EUR 1413

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1	SBI	25 ul each	EUR 627
Category: Exosomes

CLOuD9 Gene Expression Regulation Kit (includes 10 ug each of dCas9-PYL1 and dCas9-ABI1 lentivectors, and 100 ul of 0.5M Inducer Agent)
CASCL9-100A-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

SMTN sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2204005	ABM	3 x 1.0 ug	EUR 376

Smtn sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4611505	ABM	3 x 1.0 ug	EUR 376

SMTN sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K2204006	ABM	1.0 ug DNA	EUR 167

SMTN sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K2204007	ABM	1.0 ug DNA	EUR 167

SMTN sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K2204008	ABM	1.0 ug DNA	EUR 167

Smtn sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K4611506	ABM	1.0 ug DNA	EUR 167

Smtn sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K4611507	ABM	1.0 ug DNA	EUR 167

Smtn sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K4611508	ABM	1.0 ug DNA	EUR 167

AXYGEN® AXYPET® PRO STARTER KIT: 4 PIPETTORS, PLEXI STAND, SAMPLE TIPS
AP-STR-KIT-P	CORNING	1/pk	EUR 721
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-1	CORNING	1/pk	EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-2	CORNING	1/pk	EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

/ Rat ELISA Kit
ELA-E0703r	Lifescience Market	96 Tests	EUR 886

/ Rat ELISA Kit
ELA-E1084r	Lifescience Market	96 Tests	EUR 886

TRF ELISA Kit| Rat Transferrin ELISA Kit
EF018096	Lifescience Market	96 Tests	EUR 689

TRX ELISA Kit| Rat Thioredoxin ELISA Kit
EF018097	Lifescience Market	96 Tests	EUR 689

TRY ELISA Kit| Rat Trypsin ELISA Kit
EF018099	Lifescience Market	96 Tests	EUR 689

TYR ELISA Kit| Rat Tyrosinase ELISA Kit
EF018105	Lifescience Market	96 Tests	EUR 689

VF ELISA Kit| Rat Visfatin ELISA Kit
EF018113	Lifescience Market	96 Tests	EUR 689

AD ELISA Kit| Rat Adropin ELISA Kit
EF018137	Lifescience Market	96 Tests	EUR 689

T ELISA Kit| Rat Testosterone ELISA Kit
EF018139	Lifescience Market	96 Tests	EUR 689

Ach ELISA Kit| Rat Acetylcholine ELISA Kit
EF018143	Lifescience Market	96 Tests	EUR 689

CFP ELISA Kit| Rat Properdin ELISA Kit
EF018144	Lifescience Market	96 Tests	EUR 689

BrdU ELISA Kit| Rat Bromodeoxyuridine ELISA Kit
EF018146	Lifescience Market	96 Tests	EUR 689

Estrone ELISA Kit| Rat Estrone ELISA Kit
EF018156	Lifescience Market	96 Tests	EUR 689

E2 ELISA Kit| Rat Estradiol ELISA Kit
EF018157	Lifescience Market	96 Tests	EUR 689

HCY ELISA Kit| Rat Homocysteine ELISA Kit
EF018158	Lifescience Market	96 Tests	EUR 689

GAGs ELISA Kit| Rat Glycosaminoglycan ELISA Kit
EF018159	Lifescience Market	96 Tests	EUR 689

DAG ELISA Kit| Rat Diacylglycerol ELISA Kit
EF018164	Lifescience Market	96 Tests	EUR 689

MTL5 ELISA Kit| Rat Tesmin ELISA Kit
EF018168	Lifescience Market	96 Tests	EUR 689

FATP4 ELISA Kit| Rat FATP4 ELISA Kit
EF018183	Lifescience Market	96 Tests	EUR 689

Hyp ELISA Kit| Rat Hydroxyproline ELISA Kit
EF018211	Lifescience Market	96 Tests	EUR 689

Adipolin ELISA Kit| Rat FAM132A ELISA Kit
EF018220	Lifescience Market	96 Tests	EUR 689

Rat SMTN(Smoothelin) ELISA Package