Rat SMTN(Smoothelin) ELISA Kit

Rat SMTN(Smoothelin) ELISA Package

Rat Smoothelin (SMTN) ELISA Kit

RD-SMTN-Ra-48Tests 48 Tests
EUR 557

Rat Smoothelin (SMTN) ELISA Kit

RD-SMTN-Ra-96Tests 96 Tests
EUR 775

Rat Smoothelin (SMTN) ELISA Kit

RDR-SMTN-Ra-48Tests 48 Tests
EUR 583

Rat Smoothelin (SMTN) ELISA Kit

RDR-SMTN-Ra-96Tests 96 Tests
EUR 811

Human Smoothelin (SMTN) ELISA Kit

DLR-SMTN-Hu-48T 48T
EUR 517
  • Should the Human Smoothelin (SMTN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Smoothelin (SMTN) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Smoothelin (SMTN) ELISA Kit

DLR-SMTN-Hu-96T 96T
EUR 673
  • Should the Human Smoothelin (SMTN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Smoothelin (SMTN) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Smoothelin (SMTN) ELISA Kit

RD-SMTN-Hu-48Tests 48 Tests
EUR 521

Human Smoothelin (SMTN) ELISA Kit

RD-SMTN-Hu-96Tests 96 Tests
EUR 723

Human Smoothelin (SMTN) ELISA Kit

RDR-SMTN-Hu-48Tests 48 Tests
EUR 544

Human Smoothelin (SMTN) ELISA Kit

RDR-SMTN-Hu-96Tests 96 Tests
EUR 756

Rat Smoothelin (SMTN) ELISA Kit

20-abx156101
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Smoothelin (SMTN) ELISA Kit

SEC856Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Smoothelin (SMTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Smoothelin (SMTN) in Tissue homogenates, cell lysates and other biological fluids.

Rat Smoothelin (SMTN) ELISA Kit

SEC856Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Smoothelin (SMTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Smoothelin (SMTN) in Tissue homogenates, cell lysates and other biological fluids.

Rat Smoothelin (SMTN) ELISA Kit

SEC856Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Smoothelin (SMTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Smoothelin (SMTN) in Tissue homogenates, cell lysates and other biological fluids.

Rat Smoothelin (SMTN) ELISA Kit

SEC856Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Smoothelin (SMTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Smoothelin (SMTN) in Tissue homogenates, cell lysates and other biological fluids.

Rat Smoothelin (SMTN) ELISA Kit

4-SEC856Ra
  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Smoothelin elisa. Alternative names of the recognized antigen: SMSMO
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Smoothelin (SMTN) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

ELISA kit for Rat SMTN (Smoothelin)

ELK6982 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Smoothelin (SMTN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Smoothelin (SMTN
  • Show more
Description: A sandwich ELISA kit for detection of Smoothelin from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Rat Smoothelin (SMTN) Protein

20-abx167608
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Smoothelin (SMTN) CLIA Kit

20-abx493941
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Smoothelin, Smtn ELISA KIT

ELI-19062m 96 Tests
EUR 865

Human Smoothelin, SMTN ELISA KIT

ELI-52975h 96 Tests
EUR 824

Human Smoothelin (SMTN) ELISA Kit

20-abx153124
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Smoothelin (SMTN) ELISA Kit

abx390587-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Smoothelin (SMTN) ELISA Kit

SEC856Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Smoothelin (SMTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Smoothelin (SMTN) in Tissue homogenates, cell lysates and other biological fluids.

Human Smoothelin (SMTN) ELISA Kit

SEC856Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Smoothelin (SMTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Smoothelin (SMTN) in Tissue homogenates, cell lysates and other biological fluids.

Human Smoothelin (SMTN) ELISA Kit

SEC856Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Smoothelin (SMTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Smoothelin (SMTN) in Tissue homogenates, cell lysates and other biological fluids.

Human Smoothelin (SMTN) ELISA Kit

SEC856Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Smoothelin (SMTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Smoothelin (SMTN) in Tissue homogenates, cell lysates and other biological fluids.

Human Smoothelin (SMTN) ELISA Kit

4-SEC856Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Smoothelin elisa. Alternative names of the recognized antigen: SMSMO
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Smoothelin (SMTN) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Smoothelin(SMTN)ELISA Kit

QY-E04585 96T
EUR 361

Smoothelin (SMTN) Antibody

20-abx128197
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Smoothelin (SMTN) Antibody

20-abx130055
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Smoothelin (SMTN) Antibody

20-abx006625
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Smoothelin (SMTN) Antibody

20-abx174576
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Smoothelin (SMTN) Antibody

20-abx174577
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Recombinant Smoothelin (SMTN)

4-RPC856Hu01
  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P53814
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 48.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Smoothelin expressed in: E.coli

Recombinant Smoothelin (SMTN)

4-RPC856Ra01
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: D4ABA5
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 22.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Smoothelin expressed in: E.coli

Smoothelin (SMTN) Polyclonal Antibody (Rat)

4-PAC856Ra01
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SMTN (Gln748~Val911)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Smoothelin (SMTN)

ELISA kit for Human SMTN (Smoothelin)

ELK4065 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Smoothelin (SMTN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Smoothelin (SMTN
  • Show more
Description: A sandwich ELISA kit for detection of Smoothelin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Smoothelin (SMTN) CLIA Kit

20-abx493940
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Smtn ELISA Kit| Mouse Smoothelin ELISA Kit

EF016229 96 Tests
EUR 689

Human Smoothelin (SMTN) Protein

20-abx166596
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Anti-Smoothelin/SMTN Antibody

A04895 100ug/vial
EUR 294

Smoothelin (SMTN) Polyclonal Antibody (Rat), APC

4-PAC856Ra01-APC
  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SMTN (Gln748~Val911)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Smoothelin (SMTN). This antibody is labeled with APC.

Smoothelin (SMTN) Polyclonal Antibody (Rat), Biotinylated

4-PAC856Ra01-Biotin
  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SMTN (Gln748~Val911)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Smoothelin (SMTN). This antibody is labeled with Biotin.

Smoothelin (SMTN) Polyclonal Antibody (Rat), Cy3

4-PAC856Ra01-Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SMTN (Gln748~Val911)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Smoothelin (SMTN). This antibody is labeled with Cy3.

Smoothelin (SMTN) Polyclonal Antibody (Rat), FITC

4-PAC856Ra01-FITC
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SMTN (Gln748~Val911)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Smoothelin (SMTN). This antibody is labeled with FITC.

Smoothelin (SMTN) Polyclonal Antibody (Rat), HRP

4-PAC856Ra01-HRP
  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SMTN (Gln748~Val911)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Smoothelin (SMTN). This antibody is labeled with HRP.

Smoothelin (SMTN) Polyclonal Antibody (Rat), PE

4-PAC856Ra01-PE
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SMTN (Gln748~Val911)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Smoothelin (SMTN). This antibody is labeled with PE.

Smoothelin (SMTN) Polyclonal Antibody (Human)

4-PAC856Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SMTN (Gln742~Arg906)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Smoothelin (SMTN)

Smoothelin (SMTN) Polyclonal Antibody (Rat), APC-Cy7

4-PAC856Ra01-APC-Cy7
  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SMTN (Gln748~Val911)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Smoothelin (SMTN). This antibody is labeled with APC-Cy7.

Smoothelin (SMTN) Polyclonal Antibody (Human), APC

4-PAC856Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SMTN (Gln742~Arg906)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Smoothelin (SMTN). This antibody is labeled with APC.

Smoothelin (SMTN) Polyclonal Antibody (Human), Biotinylated

4-PAC856Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SMTN (Gln742~Arg906)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Smoothelin (SMTN). This antibody is labeled with Biotin.

Smoothelin (SMTN) Polyclonal Antibody (Human), Cy3

4-PAC856Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SMTN (Gln742~Arg906)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Smoothelin (SMTN). This antibody is labeled with Cy3.

Smoothelin (SMTN) Polyclonal Antibody (Human), FITC

4-PAC856Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SMTN (Gln742~Arg906)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Smoothelin (SMTN). This antibody is labeled with FITC.

Smoothelin (SMTN) Polyclonal Antibody (Human), HRP

4-PAC856Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SMTN (Gln742~Arg906)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Smoothelin (SMTN). This antibody is labeled with HRP.

Smoothelin (SMTN) Polyclonal Antibody (Human), PE

4-PAC856Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SMTN (Gln742~Arg906)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Smoothelin (SMTN). This antibody is labeled with PE.

Smoothelin (SMTN) Polyclonal Antibody (Human), APC-Cy7

4-PAC856Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SMTN (Gln742~Arg906)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Smoothelin (SMTN). This antibody is labeled with APC-Cy7.

SMTN ELISA Kit (Rat) (OKCD01249)

OKCD01249 96 Wells
EUR 896
Description: Description of target: ;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.25 ng/mL

SMTN ELISA KIT|Human

EF005579 96 Tests
EUR 689

SMTN ELISA Kit (Human) (OKCD00885)

OKCD00885 96 Wells
EUR 831
Description: Description of target: Structural protein of the cytoskeleton. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.112 ng/mL

Smoothelin Antibody

20-abx141519
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Smoothelin antibody

10R-8118 100 ug
EUR 467
Description: Mouse monoclonal Smoothelin antibody

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

SMTN siRNA

20-abx934461
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SMTN siRNA

20-abx934462
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Anti-Smoothelin antibody

STJ16100219 100 µg
EUR 446

Anti-Smoothelin antibody

STJ180240 0.1 ml
EUR 237

Smtn ORF Vector (Rat) (pORF)

ORF076722 1.0 ug DNA
EUR 506

SMTN cloning plasmid

CSB-CL021855HU-10ug 10ug
EUR 558
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2748
  • Sequence: atggcggacgaggccttagctgggctggatgagggagcccttcggaagctgctggaggtcacagcagatctggcagagcggcggcgcatccgctcagccatccgggaactgcagcggcaggagctggagcgcgaggaggaggccctggcatccaagcgtttccgtgccgagcggc
  • Show more
Description: A cloning plasmid for the SMTN gene.

SMTN Rabbit pAb

A6745-100ul 100 ul
EUR 308

SMTN Rabbit pAb

A6745-200ul 200 ul
EUR 459

SMTN Rabbit pAb

A6745-20ul 20 ul
EUR 183

SMTN Rabbit pAb

A6745-50ul 50 ul
EUR 223

SMTN Polyclonal Antibody

30729-100ul 100ul
EUR 252

SMTN Polyclonal Antibody

30729-50ul 50ul
EUR 187

Anti-SMTN antibody

STJ28828 100 µl
EUR 277
Description: This gene encodes a structural protein that is found exclusively in contractile smooth muscle cells. It associates with stress fibers and constitutes part of the cytoskeleton. This gene is localized to chromosome 22q12.3, distal to the TUPLE1 locus and outside the DiGeorge syndrome deletion. Alternative splicing of this gene results in multiple transcript variants encoding distinct isoforms.

Custom production of antibodies in 5 Rats using customer supplied antigen (std 63 days protocol)

RAT-5 1
EUR 1138

Human Smoothelin-like protein 1 (SMTNL1) ELISA Kit

abx519955-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Smoothelin-like protein 1 (SMTNL1) ELISA Kit

abx519956-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Smoothelin- like protein 2, Smtnl2 ELISA KIT

ELI-19984m 96 Tests
EUR 865

Human Smoothelin- like protein 1, SMTNL1 ELISA KIT

ELI-07294h 96 Tests
EUR 824

Mouse Smoothelin- like protein 1, Smtnl1 ELISA KIT

ELI-07295m 96 Tests
EUR 865

Human Smoothelin- like protein 2, SMTNL2 ELISA KIT

ELI-30344h 96 Tests
EUR 824

Bovine Smoothelin- like protein 2, SMTNL2 ELISA KIT

ELI-39438b 96 Tests
EUR 928

Human Smoothelin-like protein 2 (SMTNL2) ELISA Kit

abx383323-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Smoothelin-like protein 2 (SMTNL2) ELISA Kit

abx390588-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Smtnl2 ELISA Kit| Mouse Smoothelin-like protein 2 ELISA Kit

EF016230 96 Tests
EUR 689

SMTNL2 ELISA Kit| Bovine Smoothelin-like protein 2 ELISA Kit

EF011910 96 Tests
EUR 689

Smtn sgRNA CRISPR Lentivector set (Rat)

K6621001 3 x 1.0 ug
EUR 339

Anti-Human Smoothelin antibody

STJ16100450 1 mL
EUR 1396

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

SMTN Polyclonal Conjugated Antibody

C30729 100ul
EUR 397

Mouse SMTN shRNA Plasmid

20-abx973993
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human SMTN shRNA Plasmid

20-abx954419
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pENTR223-SMTN-G1939C vector

PVT11820 2 ug
EUR 304

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Smtn sgRNA CRISPR Lentivector (Rat) (Target 1)

K6621002 1.0 ug DNA
EUR 154

Smtn sgRNA CRISPR Lentivector (Rat) (Target 2)

K6621003 1.0 ug DNA
EUR 154

Smtn sgRNA CRISPR Lentivector (Rat) (Target 3)

K6621004 1.0 ug DNA
EUR 154

SMTN Protein Vector (Rat) (pPB-C-His)

PV306886 500 ng
EUR 1166

SMTN Protein Vector (Rat) (pPB-N-His)

PV306887 500 ng
EUR 1166

SMTN Protein Vector (Rat) (pPM-C-HA)

PV306888 500 ng
EUR 1166

SMTN Protein Vector (Rat) (pPM-C-His)

PV306889 500 ng
EUR 1166

Smoothelin-Like 1 (SMTNL1) Antibody

20-abx115625
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Smoothelin-Like 2 (SMTNL2) Antibody

20-abx115626
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human Smoothelin-Like 1 Phospho-Ser301 (SMTNL1 pS301) ELISA Kit

abx259851-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Smtn ORF Vector (Mouse) (pORF)

ORF058025 1.0 ug DNA
EUR 506

Smtn ORF Vector (Mouse) (pORF)

ORF058026 1.0 ug DNA
EUR 506

SMTN ORF Vector (Human) (pORF)

ORF009816 1.0 ug DNA
EUR 95

SMTN Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV621127 1.0 ug DNA
EUR 1355

SMTN Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV621131 1.0 ug DNA
EUR 1355

SMTN Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV621132 1.0 ug DNA
EUR 1355

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV200PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV205PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV220PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV225PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]

CAS9LIG-KIT 1 Kit
EUR 153
  • Category: Cas9

Smoothelin-Like Protein 2 (SMTNL2) Antibody

20-abx004012
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Smoothelin-Like Protein 2 (SMTNL2) Antibody

abx026407-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Smoothelin-Like Protein 2 (SMTNL2) Antibody

abx026407-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Smoothelin-Like Protein 2 (SMTNL2) Antibody

abx238044-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

SMTN sgRNA CRISPR Lentivector set (Human)

K2204001 3 x 1.0 ug
EUR 339

Smtn sgRNA CRISPR Lentivector set (Mouse)

K4611501 3 x 1.0 ug
EUR 339

vWF Acty. Kit

ABP-ACT-KIT 12 x 8 microwells
EUR 428

vWF Ant. Kit

ABP-TOT-KIT 12 x 8 microwells
EUR 394

Smtn sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6621005 3 x 1.0 ug
EUR 376

hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)

CAS620A-KIT 1 kit
EUR 2152
  • Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PrecisionX Multiplex gRNA Cloning Kit

CAS9-GRNA-KIT 10 rxn
EUR 445
  • Category: Cas9

SMTN sgRNA CRISPR Lentivector (Human) (Target 1)

K2204002 1.0 ug DNA
EUR 154

SMTN sgRNA CRISPR Lentivector (Human) (Target 2)

K2204003 1.0 ug DNA
EUR 154

SMTN sgRNA CRISPR Lentivector (Human) (Target 3)

K2204004 1.0 ug DNA
EUR 154

Smtn sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4611502 1.0 ug DNA
EUR 154

Smtn sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4611503 1.0 ug DNA
EUR 154

Smtn sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4611504 1.0 ug DNA
EUR 154

SMTN Protein Vector (Human) (pPB-C-His)

PV039261 500 ng
EUR 329

SMTN Protein Vector (Human) (pPB-N-His)

PV039262 500 ng
EUR 329

SMTN Protein Vector (Human) (pPM-C-HA)

PV039263 500 ng
EUR 329

SMTN Protein Vector (Human) (pPM-C-His)

PV039264 500 ng
EUR 329

SMTN Protein Vector (Mouse) (pPB-C-His)

PV232098 500 ng
EUR 1065

SMTN Protein Vector (Mouse) (pPB-N-His)

PV232099 500 ng
EUR 1065

SMTN Protein Vector (Mouse) (pPM-C-HA)

PV232100 500 ng
EUR 1065

SMTN Protein Vector (Mouse) (pPM-C-His)

PV232101 500 ng
EUR 1065

SMTN Protein Vector (Mouse) (pPB-C-His)

PV232102 500 ng
EUR 1065

SMTN Protein Vector (Mouse) (pPB-N-His)

PV232103 500 ng
EUR 1065

SMTN Protein Vector (Mouse) (pPM-C-HA)

PV232104 500 ng
EUR 1065

SMTN Protein Vector (Mouse) (pPM-C-His)

PV232105 500 ng
EUR 1065

Smtn 3'UTR GFP Stable Cell Line

TU169352 1.0 ml Ask for price

SMTN 3'UTR Luciferase Stable Cell Line

TU023759 1.0 ml
EUR 1394

Smtn 3'UTR Luciferase Stable Cell Line

TU119352 1.0 ml Ask for price

SMTN 3'UTR GFP Stable Cell Line

TU073759 1.0 ml
EUR 1394

Smtn 3'UTR Luciferase Stable Cell Line

TU220860 1.0 ml Ask for price

Smtn 3'UTR GFP Stable Cell Line

TU270860 1.0 ml Ask for price

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

Mouse Anti-Human Smoothelin monoclonal antibody, clone JID774

CABT-L2784-100uL500uL 100 uL, 500 uL
EUR 502

Smoothelin-Like 1 Phospho-Ser301 (SMTNL1 pS301) Antibody

abx238043-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Smtn sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6621006 1.0 ug DNA
EUR 167

Smtn sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6621007 1.0 ug DNA
EUR 167

Smtn sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6621008 1.0 ug DNA
EUR 167

SMTN Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV621128 1.0 ug DNA
EUR 1355

SMTN Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV621129 1.0 ug DNA
EUR 1413

SMTN Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV621130 1.0 ug DNA
EUR 1413

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

CLOuD9 Gene Expression Regulation Kit (includes 10 ug each of dCas9-PYL1 and dCas9-ABI1 lentivectors, and 100 ul of 0.5M Inducer Agent)

CASCL9-100A-KIT 1 Kit
EUR 1132
  • Category: Cas9

SMTN sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K2204005 3 x 1.0 ug
EUR 376

Smtn sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4611505 3 x 1.0 ug
EUR 376

SMTN sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K2204006 1.0 ug DNA
EUR 167

SMTN sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K2204007 1.0 ug DNA
EUR 167

SMTN sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K2204008 1.0 ug DNA
EUR 167

Smtn sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4611506 1.0 ug DNA
EUR 167

Smtn sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4611507 1.0 ug DNA
EUR 167

Smtn sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4611508 1.0 ug DNA
EUR 167

AXYGEN® AXYPET® PRO STARTER KIT: 4 PIPETTORS, PLEXI STAND, SAMPLE TIPS

AP-STR-KIT-P 1/pk
EUR 721
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

AP-STR-KIT-1 1/pk
EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

AP-STR-KIT-2 1/pk
EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

/ Rat ELISA Kit

ELA-E0703r 96 Tests
EUR 886

/ Rat ELISA Kit

ELA-E1084r 96 Tests
EUR 886

TRF ELISA Kit| Rat Transferrin ELISA Kit

EF018096 96 Tests
EUR 689

TRX ELISA Kit| Rat Thioredoxin ELISA Kit

EF018097 96 Tests
EUR 689

TRY ELISA Kit| Rat Trypsin ELISA Kit

EF018099 96 Tests
EUR 689

TYR ELISA Kit| Rat Tyrosinase ELISA Kit

EF018105 96 Tests
EUR 689

VF ELISA Kit| Rat Visfatin ELISA Kit

EF018113 96 Tests
EUR 689

AD ELISA Kit| Rat Adropin ELISA Kit

EF018137 96 Tests
EUR 689

T ELISA Kit| Rat Testosterone ELISA Kit

EF018139 96 Tests
EUR 689

Ach ELISA Kit| Rat Acetylcholine ELISA Kit

EF018143 96 Tests
EUR 689

CFP ELISA Kit| Rat Properdin ELISA Kit

EF018144 96 Tests
EUR 689

BrdU ELISA Kit| Rat Bromodeoxyuridine ELISA Kit

EF018146 96 Tests
EUR 689

Estrone ELISA Kit| Rat Estrone ELISA Kit

EF018156 96 Tests
EUR 689

E2 ELISA Kit| Rat Estradiol ELISA Kit

EF018157 96 Tests
EUR 689

HCY ELISA Kit| Rat Homocysteine ELISA Kit

EF018158 96 Tests
EUR 689

GAGs ELISA Kit| Rat Glycosaminoglycan ELISA Kit

EF018159 96 Tests
EUR 689

DAG ELISA Kit| Rat Diacylglycerol ELISA Kit

EF018164 96 Tests
EUR 689

MTL5 ELISA Kit| Rat Tesmin ELISA Kit

EF018168 96 Tests
EUR 689

FATP4 ELISA Kit| Rat FATP4 ELISA Kit

EF018183 96 Tests
EUR 689

Hyp ELISA Kit| Rat Hydroxyproline ELISA Kit

EF018211 96 Tests
EUR 689

Adipolin ELISA Kit| Rat FAM132A ELISA Kit

EF018220 96 Tests
EUR 689

Rat SMTN(Smoothelin) ELISA Package