Rat SLN(Sarcolipin) ELISA Package
Rat Sarcolipin (SLN) ELISA Kit |
RD-SLN-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Rat Sarcolipin (SLN) ELISA Kit |
RD-SLN-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 775 |
Rat Sarcolipin (SLN) ELISA Kit |
RDR-SLN-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 583 |
Rat Sarcolipin (SLN) ELISA Kit |
RDR-SLN-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 811 |
Human Sarcolipin (SLN) ELISA Kit |
DLR-SLN-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Sarcolipin (SLN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Sarcolipin (SLN) in samples from tissue homogenates or other biological fluids. |
Human Sarcolipin (SLN) ELISA Kit |
DLR-SLN-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Sarcolipin (SLN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Sarcolipin (SLN) in samples from tissue homogenates or other biological fluids. |
Human Sarcolipin (SLN) ELISA Kit |
RD-SLN-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Sarcolipin (SLN) ELISA Kit |
RD-SLN-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Sarcolipin (SLN) ELISA Kit |
RDR-SLN-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Sarcolipin (SLN) ELISA Kit |
RDR-SLN-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Rat Sarcolipin (SLN) ELISA Kit |
20-abx156065 |
Abbexa |
-
EUR 7237.00
-
EUR 3855.00
-
EUR 895.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Rat Sarcolipin (SLN) ELISA Kit |
SEC848Ra-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5124.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Sarcolipin (SLN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Sarcolipin (SLN) in Tissue homogenates and other biological fluids. |
Rat Sarcolipin (SLN) ELISA Kit |
SEC848Ra-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 509.64 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Sarcolipin (SLN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Sarcolipin (SLN) in Tissue homogenates and other biological fluids. |
Rat Sarcolipin (SLN) ELISA Kit |
SEC848Ra-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 685.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Sarcolipin (SLN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Sarcolipin (SLN) in Tissue homogenates and other biological fluids. |
Rat Sarcolipin (SLN) ELISA Kit |
SEC848Ra-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2783.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Sarcolipin (SLN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Sarcolipin (SLN) in Tissue homogenates and other biological fluids. |
Rat Sarcolipin (SLN) ELISA Kit |
4-SEC848Ra |
Cloud-Clone |
-
EUR 5175.00
-
EUR 2734.00
-
EUR 686.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Sarcolipin elisa. Alternative names of the recognized antigen: n/a
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Sarcolipin (SLN) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Rat Sarcolipin ELISA Kit (SLN) |
RK03952 |
Abclonal |
96 Tests |
EUR 521 |
ELISA kit for Rat SLN (Sarcolipin) |
ELK7068 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Sarcolipin (SLN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Sarcolipin (SLN).
- Show more
|
Description: A sandwich ELISA kit for detection of Sarcolipin from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Rat Sarcolipin (SLN) |
KTE100238-48T |
Abbkine |
48T |
EUR 332 |
- Sarcoplasmic reticulum Ca(2+)-ATPases are transmembrane proteins that catalyze the ATP-dependent transport of Ca(2+) from the cytosol into the lumen of the sarcoplasmic reticulum in muscle cells.
Sarcolipin is a small proteolipid that regulates sever
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Sarcolipin (SLN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Sarcolipin (SLN) |
KTE100238-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Sarcoplasmic reticulum Ca(2+)-ATPases are transmembrane proteins that catalyze the ATP-dependent transport of Ca(2+) from the cytosol into the lumen of the sarcoplasmic reticulum in muscle cells.
Sarcolipin is a small proteolipid that regulates sever
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Sarcolipin (SLN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Sarcolipin (SLN) |
KTE100238-96T |
Abbkine |
96T |
EUR 539 |
- Sarcoplasmic reticulum Ca(2+)-ATPases are transmembrane proteins that catalyze the ATP-dependent transport of Ca(2+) from the cytosol into the lumen of the sarcoplasmic reticulum in muscle cells.
Sarcolipin is a small proteolipid that regulates sever
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Sarcolipin (SLN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Rat Sarcolipin (SLN) Protein |
20-abx654988 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Rat Sarcolipin (SLN) CLIA Kit |
20-abx493936 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Sarcolipin (SLN) ELISA Kit |
20-abx153017 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Sarcolipin ELISA Kit (SLN) |
RK02300 |
Abclonal |
96 Tests |
EUR 521 |
Human Sarcolipin (SLN) ELISA Kit |
SEC848Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sarcolipin (SLN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sarcolipin (SLN) in Tissue homogenates and other biological fluids. |
Human Sarcolipin (SLN) ELISA Kit |
SEC848Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sarcolipin (SLN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sarcolipin (SLN) in Tissue homogenates and other biological fluids. |
Human Sarcolipin (SLN) ELISA Kit |
SEC848Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sarcolipin (SLN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sarcolipin (SLN) in Tissue homogenates and other biological fluids. |
Human Sarcolipin (SLN) ELISA Kit |
SEC848Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sarcolipin (SLN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sarcolipin (SLN) in Tissue homogenates and other biological fluids. |
Human Sarcolipin (SLN) ELISA Kit |
4-SEC848Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Sarcolipin elisa. Alternative names of the recognized antigen: n/a
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Sarcolipin (SLN) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Sarcolipin (SLN) Antibody |
20-abx178309 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Sarcolipin (SLN) Antibody |
20-abx178310 |
Abbexa |
|
|
|
Sarcolipin (SLN) Antibody |
20-abx115382 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Sarcolipin (SLN) Antibody |
20-abx174457 |
Abbexa |
|
|
|
Sarcolipin (SLN) Antibody |
20-abx174458 |
Abbexa |
|
|
|
Sarcolipin (SLN) Antibody |
abx237987-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
ELISA kit for Human SLN (Sarcolipin) |
ELK3935 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Sarcolipin (SLN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Sarcolipin (SLN).
- Show more
|
Description: A sandwich ELISA kit for detection of Sarcolipin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human Sarcolipin (SLN) |
KTE60578-48T |
Abbkine |
48T |
EUR 332 |
- Sarcoplasmic reticulum Ca(2+)-ATPases are transmembrane proteins that catalyze the ATP-dependent transport of Ca(2+) from the cytosol into the lumen of the sarcoplasmic reticulum in muscle cells.
Sarcolipin is a small proteolipid that regulates sever
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Sarcolipin (SLN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Sarcolipin (SLN) |
KTE60578-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Sarcoplasmic reticulum Ca(2+)-ATPases are transmembrane proteins that catalyze the ATP-dependent transport of Ca(2+) from the cytosol into the lumen of the sarcoplasmic reticulum in muscle cells.
Sarcolipin is a small proteolipid that regulates sever
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Sarcolipin (SLN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Sarcolipin (SLN) |
KTE60578-96T |
Abbkine |
96T |
EUR 539 |
- Sarcoplasmic reticulum Ca(2+)-ATPases are transmembrane proteins that catalyze the ATP-dependent transport of Ca(2+) from the cytosol into the lumen of the sarcoplasmic reticulum in muscle cells.
Sarcolipin is a small proteolipid that regulates sever
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Sarcolipin (SLN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Human Sarcolipin (SLN) CLIA Kit |
20-abx493935 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Sarcolipin (SLN) Protein |
20-abx654987 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Rat SLN shRNA Plasmid |
20-abx990682 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
SLN Recombinant Protein (Rat) |
RP229979 |
ABM |
100 ug |
Ask for price |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
SLN antibody |
70R-20378 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal SLN antibody |
SLN Antibody |
1-CSB-PA021780GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against SLN. Recognizes SLN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
SLN siRNA |
20-abx905135 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SLN siRNA |
20-abx934265 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SLN siRNA |
20-abx934266 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Sln ORF Vector (Rat) (pORF) |
ORF076661 |
ABM |
1.0 ug DNA |
EUR 506 |
SLN cloning plasmid |
CSB-CL021780HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 108
- Sequence: atggtcctgggattgactgagatgctccggagctgcctgctctatgccctgagaccccactgctgtcattgtcacaggatgccattctccatccgagggcacctgtga
|
Description: A cloning plasmid for the SLN gene. |
SLN cloning plasmid |
CSB-CL021780HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 96
- Sequence: ATGGGGATAAACACCCGGGAGCTGTTTCTCAACTTCACTATTGTCTTGATTACGGTTATTCTTATGTGGCTCCTTGTGAGGTCCTATCAGTACTGA
|
Description: A cloning plasmid for the SLN gene. |
anti- SLN antibody |
FNab07987 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500-1:1000
- IHC: 1:50-1:500
- IF: 1:20-1:200
- Immunogen: sarcolipin
- Uniprot ID: O00631
- Gene ID: 6588
- Research Area: Cardiovascular, Metabolism
|
Description: Antibody raised against SLN |
Custom production of antibodies in 5 Rats using customer supplied antigen (std 63 days protocol) |
RAT-5 |
Alpha Diagnostics |
1 |
EUR 1138 |
Sln sgRNA CRISPR Lentivector set (Rat) |
K6259301 |
ABM |
3 x 1.0 ug |
EUR 339 |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
Mouse SLN shRNA Plasmid |
20-abx975588 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human SLN shRNA Plasmid |
20-abx954475 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
SLN Recombinant Protein (Human) |
RP043588 |
ABM |
100 ug |
Ask for price |
SLN Recombinant Protein (Human) |
RP029320 |
ABM |
100 ug |
Ask for price |
SLN Recombinant Protein (Mouse) |
RP173738 |
ABM |
100 ug |
Ask for price |
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
Sln sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6259302 |
ABM |
1.0 ug DNA |
EUR 154 |
Sln sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6259303 |
ABM |
1.0 ug DNA |
EUR 154 |
Sln sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6259304 |
ABM |
1.0 ug DNA |
EUR 154 |
SLN Protein Vector (Rat) (pPB-C-His) |
PV306642 |
ABM |
500 ng |
EUR 603 |
SLN Protein Vector (Rat) (pPB-N-His) |
PV306643 |
ABM |
500 ng |
EUR 603 |
SLN Protein Vector (Rat) (pPM-C-HA) |
PV306644 |
ABM |
500 ng |
EUR 603 |
Rat SLN(Sarcolipin) ELISA Package