Rat SLN(Sarcolipin) ELISA Kit

Rat SLN(Sarcolipin) ELISA Package

Rat Sarcolipin (SLN) ELISA Kit

RD-SLN-Ra-48Tests 48 Tests
EUR 557

Rat Sarcolipin (SLN) ELISA Kit

RD-SLN-Ra-96Tests 96 Tests
EUR 775

Rat Sarcolipin (SLN) ELISA Kit

RDR-SLN-Ra-48Tests 48 Tests
EUR 583

Rat Sarcolipin (SLN) ELISA Kit

RDR-SLN-Ra-96Tests 96 Tests
EUR 811

Human Sarcolipin (SLN) ELISA Kit

DLR-SLN-Hu-48T 48T
EUR 517
  • Should the Human Sarcolipin (SLN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Sarcolipin (SLN) in samples from tissue homogenates or other biological fluids.

Human Sarcolipin (SLN) ELISA Kit

DLR-SLN-Hu-96T 96T
EUR 673
  • Should the Human Sarcolipin (SLN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Sarcolipin (SLN) in samples from tissue homogenates or other biological fluids.

Human Sarcolipin (SLN) ELISA Kit

RD-SLN-Hu-48Tests 48 Tests
EUR 521

Human Sarcolipin (SLN) ELISA Kit

RD-SLN-Hu-96Tests 96 Tests
EUR 723

Human Sarcolipin (SLN) ELISA Kit

RDR-SLN-Hu-48Tests 48 Tests
EUR 544

Human Sarcolipin (SLN) ELISA Kit

RDR-SLN-Hu-96Tests 96 Tests
EUR 756

Rat Sarcolipin (SLN) ELISA Kit

  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Sarcolipin, Sln ELISA KIT

ELI-18888r 96 Tests
EUR 886

Rat Sarcolipin (SLN) ELISA Kit

SEC848Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Sarcolipin (SLN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Sarcolipin (SLN) in Tissue homogenates and other biological fluids.

Rat Sarcolipin (SLN) ELISA Kit

SEC848Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Sarcolipin (SLN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Sarcolipin (SLN) in Tissue homogenates and other biological fluids.

Rat Sarcolipin (SLN) ELISA Kit

SEC848Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Sarcolipin (SLN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Sarcolipin (SLN) in Tissue homogenates and other biological fluids.

Rat Sarcolipin (SLN) ELISA Kit

SEC848Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Sarcolipin (SLN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Sarcolipin (SLN) in Tissue homogenates and other biological fluids.

Rat Sarcolipin (SLN) ELISA Kit

  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Sarcolipin elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Sarcolipin (SLN) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Rat Sarcolipin ELISA Kit (SLN)

RK03952 96 Tests
EUR 521

Rat Sarcolipin (SLN) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

ELISA kit for Rat SLN (Sarcolipin)

ELK7068 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Sarcolipin (SLN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Sarcolipin (SLN).
  • Show more
Description: A sandwich ELISA kit for detection of Sarcolipin from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Rat Sarcolipin (SLN)

KTE100238-48T 48T
EUR 332
  • Sarcoplasmic reticulum Ca(2+)-ATPases are transmembrane proteins that catalyze the ATP-dependent transport of Ca(2+) from the cytosol into the lumen of the sarcoplasmic reticulum in muscle cells. Sarcolipin is a small proteolipid that regulates sever
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Sarcolipin (SLN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Sarcolipin (SLN)

KTE100238-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Sarcoplasmic reticulum Ca(2+)-ATPases are transmembrane proteins that catalyze the ATP-dependent transport of Ca(2+) from the cytosol into the lumen of the sarcoplasmic reticulum in muscle cells. Sarcolipin is a small proteolipid that regulates sever
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Sarcolipin (SLN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Sarcolipin (SLN)

KTE100238-96T 96T
EUR 539
  • Sarcoplasmic reticulum Ca(2+)-ATPases are transmembrane proteins that catalyze the ATP-dependent transport of Ca(2+) from the cytosol into the lumen of the sarcoplasmic reticulum in muscle cells. Sarcolipin is a small proteolipid that regulates sever
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Sarcolipin (SLN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Rat Sarcolipin (SLN) CLIA Kit

  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Sarcolipin (SLN) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Sarcolipin, Sln ELISA KIT

ELI-20144m 96 Tests
EUR 865

Rabbit Sarcolipin, SLN ELISA KIT

ELI-20145Ra 96 Tests
EUR 928

Human Sarcolipin, SLN ELISA KIT

ELI-29539h 96 Tests
EUR 824

Human Sarcolipin(SLN)ELISA Kit

QY-E03004 96T
EUR 361

Human Sarcolipin ELISA Kit (SLN)

RK02300 96 Tests
EUR 521

Human Sarcolipin (SLN) ELISA Kit

SEC848Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sarcolipin (SLN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sarcolipin (SLN) in Tissue homogenates and other biological fluids.

Human Sarcolipin (SLN) ELISA Kit

SEC848Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sarcolipin (SLN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sarcolipin (SLN) in Tissue homogenates and other biological fluids.

Human Sarcolipin (SLN) ELISA Kit

SEC848Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sarcolipin (SLN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sarcolipin (SLN) in Tissue homogenates and other biological fluids.

Human Sarcolipin (SLN) ELISA Kit

SEC848Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sarcolipin (SLN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sarcolipin (SLN) in Tissue homogenates and other biological fluids.

Human Sarcolipin (SLN) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Sarcolipin elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Sarcolipin (SLN) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Sarcolipin (SLN) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Sarcolipin (SLN) Antibody

  • EUR 1302.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Sarcolipin (SLN) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sarcolipin (SLN) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Sarcolipin (SLN) Antibody

  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Sarcolipin (SLN) Antibody

abx237987-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

ELISA kit for Human SLN (Sarcolipin)

ELK3935 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Sarcolipin (SLN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Sarcolipin (SLN).
  • Show more
Description: A sandwich ELISA kit for detection of Sarcolipin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Sarcolipin (SLN)

KTE60578-48T 48T
EUR 332
  • Sarcoplasmic reticulum Ca(2+)-ATPases are transmembrane proteins that catalyze the ATP-dependent transport of Ca(2+) from the cytosol into the lumen of the sarcoplasmic reticulum in muscle cells. Sarcolipin is a small proteolipid that regulates sever
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Sarcolipin (SLN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Sarcolipin (SLN)

KTE60578-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Sarcoplasmic reticulum Ca(2+)-ATPases are transmembrane proteins that catalyze the ATP-dependent transport of Ca(2+) from the cytosol into the lumen of the sarcoplasmic reticulum in muscle cells. Sarcolipin is a small proteolipid that regulates sever
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Sarcolipin (SLN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Sarcolipin (SLN)

KTE60578-96T 96T
EUR 539
  • Sarcoplasmic reticulum Ca(2+)-ATPases are transmembrane proteins that catalyze the ATP-dependent transport of Ca(2+) from the cytosol into the lumen of the sarcoplasmic reticulum in muscle cells. Sarcolipin is a small proteolipid that regulates sever
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Sarcolipin (SLN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Sarcolipin (SLN) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Sarcolipin (SLN) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

SLN ELISA Kit (Rat) (OKDD00843)

OKDD00843 96 Wells
EUR 1040
Description: Description of target: Reversibly inhibits the activity of atp2a1 in sarcoplasmic reticulum by decreasing the apparent affinity of the atpase for ca2+. modulates calcium re-uptake during muscle relaxation and plays an important role in calcium homeostasis in muscle. required for muscle-based, non-shivering thermogenesis (by similarity).;Species reactivity: Rat;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.058ng/mL


EF003037 96 Tests
EUR 689

SLN ELISA Kit (Human) (OKCD01707)

OKCD01707 96 Wells
EUR 831
Description: Description of target: Reversibly inhibits the activity of ATP2A1 in sarcoplasmic reticulum by decreasing the apparent affinity of the ATPase for Ca2+. Modulates calcium re-uptake during muscle relaxation and plays an important role in calcium homeostasis in muscle. Required for muscle-based, non-shivering thermogenesis.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.121 ng/mL

Rat SLN shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SLN Recombinant Protein (Rat)

RP229979 100 ug Ask for price

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

SLN antibody

70R-20378 50 ul
EUR 435
Description: Rabbit polyclonal SLN antibody

SLN Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SLN. Recognizes SLN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Sln ORF Vector (Rat) (pORF)

ORF076661 1.0 ug DNA
EUR 506

SLN cloning plasmid

CSB-CL021780HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 108
  • Sequence: atggtcctgggattgactgagatgctccggagctgcctgctctatgccctgagaccccactgctgtcattgtcacaggatgccattctccatccgagggcacctgtga
Description: A cloning plasmid for the SLN gene.

SLN cloning plasmid

CSB-CL021780HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 96
Description: A cloning plasmid for the SLN gene.

anti- SLN antibody

FNab07987 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:50-1:500
  • IF: 1:20-1:200
  • Immunogen: sarcolipin
  • Uniprot ID: O00631
  • Gene ID: 6588
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against SLN

Anti-SLN antibody

PAab07987 100 ug
EUR 386

Custom production of antibodies in 5 Rats using customer supplied antigen (std 63 days protocol)

RAT-5 1
EUR 1138

Sln sgRNA CRISPR Lentivector set (Rat)

K6259301 3 x 1.0 ug
EUR 339

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Mouse SLN shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human SLN shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SLN Recombinant Protein (Human)

RP043588 100 ug Ask for price

SLN Recombinant Protein (Human)

RP029320 100 ug Ask for price

SLN Recombinant Protein (Mouse)

RP173738 100 ug Ask for price

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Sln sgRNA CRISPR Lentivector (Rat) (Target 1)

K6259302 1.0 ug DNA
EUR 154

Sln sgRNA CRISPR Lentivector (Rat) (Target 2)

K6259303 1.0 ug DNA
EUR 154

Sln sgRNA CRISPR Lentivector (Rat) (Target 3)

K6259304 1.0 ug DNA
EUR 154

SLN Protein Vector (Rat) (pPB-C-His)

PV306642 500 ng
EUR 603

Rat SLN(Sarcolipin) ELISA Package