Rat PRCP(Prolylcarboxypeptidase) ELISA Kit

Rat PRCP(Prolylcarboxypeptidase) ELISA Equipment

Rat Prolylcarboxypeptidase (PRCP) ELISA Kit
RDR-PRCP-Ra-48Tests	Reddot Biotech	48 Tests	EUR 558

Rat Prolylcarboxypeptidase (PRCP) ELISA Kit
RDR-PRCP-Ra-96Tests	Reddot Biotech	96 Tests	EUR 776

Rat Prolylcarboxypeptidase (PRCP) ELISA Kit
RD-PRCP-Ra-48Tests	Reddot Biotech	48 Tests	EUR 534

Rat Prolylcarboxypeptidase (PRCP) ELISA Kit
RD-PRCP-Ra-96Tests	Reddot Biotech	96 Tests	EUR 742

Human Prolylcarboxypeptidase (PRCP) ELISA Kit
DLR-PRCP-Hu-48T	DL Develop	48T	EUR 498
Should the Human Prolylcarboxypeptidase (PRCP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Prolylcarboxypeptidase (PRCP) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Prolylcarboxypeptidase (PRCP) ELISA Kit
DLR-PRCP-Hu-96T	DL Develop	96T	EUR 647
Should the Human Prolylcarboxypeptidase (PRCP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Prolylcarboxypeptidase (PRCP) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Prolylcarboxypeptidase (PRCP) ELISA Kit
RDR-PRCP-Hu-48Tests	Reddot Biotech	48 Tests	EUR 522

Human Prolylcarboxypeptidase (PRCP) ELISA Kit
RDR-PRCP-Hu-96Tests	Reddot Biotech	96 Tests	EUR 724

Human Prolylcarboxypeptidase (PRCP) ELISA Kit
RD-PRCP-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Prolylcarboxypeptidase (PRCP) ELISA Kit
RD-PRCP-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Rat Prolylcarboxypeptidase (PRCP) ELISA Kit
20-abx156001	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Rat Prolylcarboxypeptidase (PRCP) ELISA Kit
abx255952-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Rat PRCP(Prolylcarboxypeptidase) ELISA Kit
ER1287	FN Test	96T	EUR 524.1
Detection range: 0.156-10 ng/ml Alias: PRCP/Angiotensinase C/HUMPCP/Angiotensinase C/EC 3.4.16.2/HUMPCP/Lysosomal carboxypeptidase C/lysosomal Pro-X carboxypeptidase/PCPMGC2202/Proline carboxypeptidase/Prolylcarboxypeptidase/prolylcarboxypeptidase(an Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.094 ng/ml

Rat Prolylcarboxypeptidase(PRCP)ELISA Kit
QY-E10042	Qayee Biotechnology	96T	EUR 361

Rat Prolylcarboxypeptidase (PRCP) ELISA Kit
SEB253Ra-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4875.49
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Prolylcarboxypeptidase (PRCP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Prolylcarboxypeptidase (PRCP) in serum, plasma, tissue homogenates and other biological fluids.

Rat Prolylcarboxypeptidase (PRCP) ELISA Kit
SEB253Ra-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 489.16
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Prolylcarboxypeptidase (PRCP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Prolylcarboxypeptidase (PRCP) in serum, plasma, tissue homogenates and other biological fluids.

Rat Prolylcarboxypeptidase (PRCP) ELISA Kit
SEB253Ra-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 655.94
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Prolylcarboxypeptidase (PRCP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Prolylcarboxypeptidase (PRCP) in serum, plasma, tissue homogenates and other biological fluids.

Rat Prolylcarboxypeptidase (PRCP) ELISA Kit
SEB253Ra-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2651.73
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Prolylcarboxypeptidase (PRCP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Prolylcarboxypeptidase (PRCP) in serum, plasma, tissue homogenates and other biological fluids.

Rat Prolylcarboxypeptidase (PRCP) ELISA Kit
4-SEB253Ra	Cloud-Clone	EUR 4926.00 EUR 2602.00 EUR 656.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Prolylcarboxypeptidase elisa. Alternative names of the recognized antigen: PCP HUMPCP Lysosomal Pro-X Carboxypeptidase Angiotensinase C Lysosomal carboxypeptidase C Proline carboxypeptidase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Prolylcarboxypeptidase (PRCP) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

ELISA kit for Rat PRCP (Prolylcarboxypeptidase)
E-EL-R0784	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's PRCP ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat PRCP. Standards or samples are added to the micro ELISA plate wells and combined with the Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat PRCP (Prolylcarboxypeptidase) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Rat PRCP (Prolylcarboxypeptidase)
ELK7279	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Prolylcarboxypeptidase (PRCP). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Prol Show more
Description: A sandwich ELISA kit for detection of Prolylcarboxypeptidase from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Rat Prolylcarboxypeptidase (PRCP) CLIA Kit
abx197560-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rat Prolylcarboxypeptidase (PRCP) CLIA Kit
20-abx492553	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Rat Prolylcarboxypeptidase (PRCP) Protein
20-abx068691	Abbexa	EUR 732.00 EUR 286.00 EUR 2263.00 EUR 871.00 EUR 523.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

PRCP ELISA Kit| Rat Prolylcarboxypeptidase ELISA Kit
EF017999	Lifescience Market	96 Tests	EUR 689

Human Prolylcarboxypeptidase (PRCP) ELISA Kit
20-abx152816	Abbexa	EUR 7112.00 EUR 3792.00 EUR 879.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Prolylcarboxypeptidase (PRCP) ELISA Kit
abx253036-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human PRCP(Prolylcarboxypeptidase) ELISA Kit
EH3647	FN Test	96T	EUR 524.1
Detection range: 0.156-10 ng/ml Uniprot ID: P42785 Alias: PRCP/Angiotensinase C/HUMPCP/Angiotensinase C/HUMPCP/Lysosomal carboxypeptidase C/lysosomal Pro-X carboxypeptidase/Proline carboxypeptidase/Prolylcarboxypeptidase/prolylcarboxypeptidase(angiot Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Pig Prolylcarboxypeptidase (PRCP) ELISA Kit
abx360703-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit Prolylcarboxypeptidase (PRCP) ELISA Kit
abx362822-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Chicken Prolylcarboxypeptidase (PRCP) ELISA Kit
abx356312-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Monkey Prolylcarboxypeptidase (PRCP) ELISA Kit
abx358738-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Mouse Prolylcarboxypeptidase (PRCP) ELISA Kit
abx390310-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Prolylcarboxypeptidase(PRCP)ELISA Kit
QY-E03540	Qayee Biotechnology	96T	EUR 361

Human Prolylcarboxypeptidase (PRCP) ELISA Kit
SEB253Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4502.43
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prolylcarboxypeptidase (PRCP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prolylcarboxypeptidase (PRCP) in serum, plasma, tissue homogenates, urine and other biological fluids.

Human Prolylcarboxypeptidase (PRCP) ELISA Kit
SEB253Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 458.44
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prolylcarboxypeptidase (PRCP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prolylcarboxypeptidase (PRCP) in serum, plasma, tissue homogenates, urine and other biological fluids.

Human Prolylcarboxypeptidase (PRCP) ELISA Kit
SEB253Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 612.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prolylcarboxypeptidase (PRCP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prolylcarboxypeptidase (PRCP) in serum, plasma, tissue homogenates, urine and other biological fluids.

Human Prolylcarboxypeptidase (PRCP) ELISA Kit
SEB253Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2454.23
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prolylcarboxypeptidase (PRCP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prolylcarboxypeptidase (PRCP) in serum, plasma, tissue homogenates, urine and other biological fluids.

Human Prolylcarboxypeptidase (PRCP) ELISA Kit
4-SEB253Hu	Cloud-Clone	EUR 4553.00 EUR 2405.00 EUR 613.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Prolylcarboxypeptidase elisa. Alternative names of the recognized antigen: PCP HUMPCP Lysosomal Pro-X Carboxypeptidase Angiotensinase C Lysosomal carboxypeptidase C Proline carboxypeptidase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Prolylcarboxypeptidase (PRCP) in samples from Serum, plasma, tissue homogenates, urine and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Prolylcarboxypeptidase(PRCP)ELISA Kit
QY-E21241	Qayee Biotechnology	96T	EUR 361

Prolylcarboxypeptidase (PRCP) Antibody
abx027380-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Prolylcarboxypeptidase (PRCP) Antibody
abx027380-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Prolylcarboxypeptidase (PRCP) Antibody
20-abx002965	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Prolylcarboxypeptidase (PRCP) Antibody
20-abx211784	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Prolylcarboxypeptidase (PRCP) Antibody
20-abx211785	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Prolylcarboxypeptidase (PRCP) Antibody
20-abx102286	Abbexa	EUR 439.00 EUR 133.00 EUR 1247.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Prolylcarboxypeptidase (PRCP) Antibody
abx036095-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Prolylcarboxypeptidase (PRCP) Antibody
20-abx128900	Abbexa	EUR 411.00 EUR 133.00 EUR 1149.00 EUR 565.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Prolylcarboxypeptidase (PRCP) Antibody
20-abx129400	Abbexa	EUR 425.00 EUR 133.00 EUR 1177.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Prolylcarboxypeptidase (PRCP) Antibody
20-abx174194	Abbexa	EUR 815.00 EUR 425.00	1 mg 200 ug
Please enquire.

Prolylcarboxypeptidase (PRCP) Antibody
20-abx174195	Abbexa	EUR 871.00 EUR 453.00	1 mg 200 ug
Please enquire.

Prolylcarboxypeptidase (PRCP) Antibody
abx236751-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Prolylcarboxypeptidase (PRCP) Antibody
20-abx333723	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Recombinant Prolylcarboxypeptidase (PRCP)
4-RPB253Hu01	Cloud-Clone	EUR 458.40 EUR 226.00 EUR 1444.00 EUR 548.00 EUR 996.00 EUR 370.00 EUR 3460.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P42785 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 33.8kDa Isoelectric Point: 6.4
Description: Recombinant Human Prolylcarboxypeptidase expressed in: E.coli

Recombinant Prolylcarboxypeptidase (PRCP)
4-RPB253Mu01	Cloud-Clone	EUR 494.24 EUR 235.00 EUR 1578.40 EUR 592.80 EUR 1085.60 EUR 394.00 EUR 3796.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q7TMR0 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 60.5KDa Isoelectric Point: Inquire
Description: Recombinant Mouse Prolylcarboxypeptidase expressed in: E.coli

Recombinant Prolylcarboxypeptidase (PRCP)
4-RPB253Ra01	Cloud-Clone	EUR 521.12 EUR 242.00 EUR 1679.20 EUR 626.40 EUR 1152.80 EUR 412.00 EUR 4048.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: D4AA31 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 30.5kDa Isoelectric Point: 8.5
Description: Recombinant Rat Prolylcarboxypeptidase expressed in: E.coli

CLIA kit for Rat PRCP (Prolylcarboxypeptidase)
E-CL-R0557	Elabscience Biotech	1 plate of 96 wells	EUR 584
Gentaur's PRCP CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Rat PRCP . Standards or samples are added to the micro CLIA plate wells and combined with the sp Show more
Description: A sandwich CLIA kit for quantitative measurement of Rat PRCP (Prolylcarboxypeptidase) in samples from Serum, Plasma, Cell supernatant

Prolylcarboxypeptidase (PRCP) Polyclonal Antibody (Rat)
4-PAB253Ra01	Cloud-Clone	EUR 251.00 EUR 2589.00 EUR 643.00 EUR 317.00 EUR 216.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRCP (Met113~Ser350) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Prolylcarboxypeptidase (PRCP)

ELISA kit for Human PRCP (Prolylcarboxypeptidase)
E-EL-H1281	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's PRCP ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human PRCP. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human PRCP (Prolylcarboxypeptidase) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human PRCP (Prolylcarboxypeptidase)
ELK4632	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Prolylcarboxypeptidase (PRCP). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Prol Show more
Description: A sandwich ELISA kit for detection of Prolylcarboxypeptidase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Prolylcarboxypeptidase (PRCP) CLIA Kit
20-abx492552	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Prolylcarboxypeptidase (PRCP) Protein
20-abx166490	Abbexa	EUR 648.00 EUR 272.00 EUR 1943.00 EUR 759.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Mouse Prolylcarboxypeptidase (PRCP) Protein
20-abx167359	Abbexa	EUR 690.00 EUR 286.00 EUR 2124.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Prolylcarboxypeptidase (PRCP) Antibody (HRP)
20-abx336423	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Prolylcarboxypeptidase (PRCP) Antibody (FITC)
20-abx336424	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Prolylcarboxypeptidase (PRCP) Antibody (Biotin)
20-abx336425	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Prolylcarboxypeptidase (PRCP) Polyclonal Antibody (Rat), APC
4-PAB253Ra01-APC	Cloud-Clone	EUR 352.00 EUR 3383.00 EUR 939.00 EUR 450.00 EUR 223.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRCP (Met113~Ser350) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Prolylcarboxypeptidase (PRCP). This antibody is labeled with APC.

Prolylcarboxypeptidase (PRCP) Polyclonal Antibody (Rat), Biotinylated
4-PAB253Ra01-Biotin	Cloud-Clone	EUR 316.00 EUR 2539.00 EUR 747.00 EUR 388.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRCP (Met113~Ser350) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Prolylcarboxypeptidase (PRCP). This antibody is labeled with Biotin.

Prolylcarboxypeptidase (PRCP) Polyclonal Antibody (Rat), Cy3
4-PAB253Ra01-Cy3	Cloud-Clone	EUR 428.00 EUR 4469.00 EUR 1211.00 EUR 559.00 EUR 255.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRCP (Met113~Ser350) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Prolylcarboxypeptidase (PRCP). This antibody is labeled with Cy3.

Prolylcarboxypeptidase (PRCP) Polyclonal Antibody (Rat), FITC
4-PAB253Ra01-FITC	Cloud-Clone	EUR 302.00 EUR 2726.00 EUR 771.00 EUR 380.00 EUR 198.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRCP (Met113~Ser350) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Prolylcarboxypeptidase (PRCP). This antibody is labeled with FITC.

Prolylcarboxypeptidase (PRCP) Polyclonal Antibody (Rat), HRP
4-PAB253Ra01-HRP	Cloud-Clone	EUR 322.00 EUR 2948.00 EUR 830.00 EUR 407.00 EUR 210.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRCP (Met113~Ser350) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Prolylcarboxypeptidase (PRCP). This antibody is labeled with HRP.

Prolylcarboxypeptidase (PRCP) Polyclonal Antibody (Rat), PE
4-PAB253Ra01-PE	Cloud-Clone	EUR 302.00 EUR 2726.00 EUR 771.00 EUR 380.00 EUR 198.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRCP (Met113~Ser350) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Prolylcarboxypeptidase (PRCP). This antibody is labeled with PE.

Prolylcarboxypeptidase (PRCP) Polyclonal Antibody (Human)
4-PAB253Hu01	Cloud-Clone	EUR 239.00 EUR 2391.00 EUR 598.00 EUR 299.00 EUR 211.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRCP (Asp108~Val376) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Prolylcarboxypeptidase (PRCP)

Prolylcarboxypeptidase (PRCP) Polyclonal Antibody (Mouse)
4-PAB253Mu01	Cloud-Clone	EUR 243.00 EUR 2457.00 EUR 613.00 EUR 305.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRCP (Gln169~Leu443) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prolylcarboxypeptidase (PRCP)

Prolylcarboxypeptidase (PRCP) Polyclonal Antibody (Rat), APC-Cy7
4-PAB253Ra01-APC-Cy7	Cloud-Clone	EUR 585.00 EUR 6646.00 EUR 1759.00 EUR 781.00 EUR 326.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRCP (Met113~Ser350) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Prolylcarboxypeptidase (PRCP). This antibody is labeled with APC-Cy7.

Prolylcarboxypeptidase (PRCP) Polyclonal Antibody (Human), APC
4-PAB253Hu01-APC	Cloud-Clone	EUR 333.00 EUR 3113.00 EUR 872.00 EUR 423.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRCP (Asp108~Val376) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Prolylcarboxypeptidase (PRCP). This antibody is labeled with APC.

Prolylcarboxypeptidase (PRCP) Polyclonal Antibody (Human), Biotinylated
4-PAB253Hu01-Biotin	Cloud-Clone	EUR 303.00 EUR 2341.00 EUR 697.00 EUR 369.00 EUR 216.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRCP (Asp108~Val376) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Prolylcarboxypeptidase (PRCP). This antibody is labeled with Biotin.

Prolylcarboxypeptidase (PRCP) Polyclonal Antibody (Human), Cy3
4-PAB253Hu01-Cy3	Cloud-Clone	EUR 403.00 EUR 4109.00 EUR 1121.00 EUR 523.00 EUR 245.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRCP (Asp108~Val376) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Prolylcarboxypeptidase (PRCP). This antibody is labeled with Cy3.

Prolylcarboxypeptidase (PRCP) Polyclonal Antibody (Human), FITC
4-PAB253Hu01-FITC	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRCP (Asp108~Val376) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Prolylcarboxypeptidase (PRCP). This antibody is labeled with FITC.

Prolylcarboxypeptidase (PRCP) Polyclonal Antibody (Human), HRP
4-PAB253Hu01-HRP	Cloud-Clone	EUR 305.00 EUR 2714.00 EUR 772.00 EUR 383.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRCP (Asp108~Val376) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Prolylcarboxypeptidase (PRCP). This antibody is labeled with HRP.

Prolylcarboxypeptidase (PRCP) Polyclonal Antibody (Human), PE
4-PAB253Hu01-PE	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRCP (Asp108~Val376) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Prolylcarboxypeptidase (PRCP). This antibody is labeled with PE.

Prolylcarboxypeptidase (PRCP) Polyclonal Antibody (Mouse), APC
4-PAB253Mu01-APC	Cloud-Clone	EUR 340.00 EUR 3203.00 EUR 894.00 EUR 432.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRCP (Gln169~Leu443) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prolylcarboxypeptidase (PRCP). This antibody is labeled with APC.

Prolylcarboxypeptidase (PRCP) Polyclonal Antibody (Mouse), Biotinylated
4-PAB253Mu01-Biotin	Cloud-Clone	EUR 307.00 EUR 2407.00 EUR 714.00 EUR 375.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRCP (Gln169~Leu443) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prolylcarboxypeptidase (PRCP). This antibody is labeled with Biotin.

Prolylcarboxypeptidase (PRCP) Polyclonal Antibody (Mouse), Cy3
4-PAB253Mu01-Cy3	Cloud-Clone	EUR 411.00 EUR 4229.00 EUR 1151.00 EUR 535.00 EUR 248.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRCP (Gln169~Leu443) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prolylcarboxypeptidase (PRCP). This antibody is labeled with Cy3.

Prolylcarboxypeptidase (PRCP) Polyclonal Antibody (Mouse), FITC
4-PAB253Mu01-FITC	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRCP (Gln169~Leu443) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prolylcarboxypeptidase (PRCP). This antibody is labeled with FITC.

Prolylcarboxypeptidase (PRCP) Polyclonal Antibody (Mouse), HRP
4-PAB253Mu01-HRP	Cloud-Clone	EUR 311.00 EUR 2792.00 EUR 791.00 EUR 391.00 EUR 205.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRCP (Gln169~Leu443) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prolylcarboxypeptidase (PRCP). This antibody is labeled with HRP.

Prolylcarboxypeptidase (PRCP) Polyclonal Antibody (Mouse), PE
4-PAB253Mu01-PE	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRCP (Gln169~Leu443) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prolylcarboxypeptidase (PRCP). This antibody is labeled with PE.

Prolylcarboxypeptidase (PRCP) Polyclonal Antibody (Human), APC-Cy7
4-PAB253Hu01-APC-Cy7	Cloud-Clone	EUR 547.00 EUR 6106.00 EUR 1624.00 EUR 727.00 EUR 310.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRCP (Asp108~Val376) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Prolylcarboxypeptidase (PRCP). This antibody is labeled with APC-Cy7.

Prolylcarboxypeptidase (PRCP) Polyclonal Antibody (Mouse), APC-Cy7
4-PAB253Mu01-APC-Cy7	Cloud-Clone	EUR 560.00 EUR 6286.00 EUR 1669.00 EUR 745.00 EUR 315.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRCP (Gln169~Leu443) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prolylcarboxypeptidase (PRCP). This antibody is labeled with APC-Cy7.

Rat Prolylcarboxypeptidase ELISA kit
E02P0137-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Prolylcarboxypeptidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Prolylcarboxypeptidase ELISA kit
E02P0137-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Prolylcarboxypeptidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Prolylcarboxypeptidase ELISA kit
E02P0137-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Prolylcarboxypeptidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat PRCP ELISA Kit
ERP0144	Abclonal	96Tests	EUR 521

Rabbit Prolylcarboxypeptidase ELISA kit
E04P0137-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Prolylcarboxypeptidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Prolylcarboxypeptidase ELISA kit
E04P0137-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Prolylcarboxypeptidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Prolylcarboxypeptidase ELISA kit
E04P0137-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Prolylcarboxypeptidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Prolylcarboxypeptidase ELISA kit
E03P0137-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Prolylcarboxypeptidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Prolylcarboxypeptidase ELISA kit
E03P0137-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Prolylcarboxypeptidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Prolylcarboxypeptidase ELISA kit
E03P0137-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Prolylcarboxypeptidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Prolylcarboxypeptidase ELISA kit
E01P0137-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Prolylcarboxypeptidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Prolylcarboxypeptidase ELISA kit
E01P0137-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Prolylcarboxypeptidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Prolylcarboxypeptidase ELISA kit
E01P0137-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Prolylcarboxypeptidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Prolylcarboxypeptidase ELISA kit
E08P0137-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Prolylcarboxypeptidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Prolylcarboxypeptidase ELISA kit
E08P0137-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Prolylcarboxypeptidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Prolylcarboxypeptidase ELISA kit
E08P0137-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Prolylcarboxypeptidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Prolylcarboxypeptidase ELISA kit
E06P0137-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Prolylcarboxypeptidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Prolylcarboxypeptidase ELISA kit
E06P0137-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Prolylcarboxypeptidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Prolylcarboxypeptidase ELISA kit
E06P0137-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Prolylcarboxypeptidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Prolylcarboxypeptidase ELISA kit
E07P0137-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Prolylcarboxypeptidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Prolylcarboxypeptidase ELISA kit
E07P0137-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Prolylcarboxypeptidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Prolylcarboxypeptidase ELISA kit
E07P0137-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Prolylcarboxypeptidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Prolylcarboxypeptidase ELISA kit
E09P0137-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Prolylcarboxypeptidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Prolylcarboxypeptidase ELISA kit
E09P0137-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Prolylcarboxypeptidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Prolylcarboxypeptidase ELISA kit
E09P0137-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Prolylcarboxypeptidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human PRCP ELISA Kit
EHP0144	Abclonal	96Tests	EUR 521

Bovine PRCP ELISA Kit
EBP0144	Abclonal	96Tests	EUR 521

Anserini PRCP ELISA Kit
EAP0144	Abclonal	96Tests	EUR 521

Chicken PRCP ELISA Kit
ECKP0144	Abclonal	96Tests	EUR 521

Canine PRCP ELISA Kit
ECP0144	Abclonal	96Tests	EUR 521

Goat PRCP ELISA Kit
EGTP0144	Abclonal	96Tests	EUR 521

PRCP ELISA KIT|Human
EF007108	Lifescience Market	96 Tests	EUR 689

Porcine PRCP ELISA Kit
EPP0144	Abclonal	96Tests	EUR 521

Sheep PRCP ELISA Kit
ESP0144	Abclonal	96Tests	EUR 521

Rabbit PRCP ELISA Kit
ERTP0144	Abclonal	96Tests	EUR 521

Monkey PRCP ELISA Kit
EMKP0144	Abclonal	96Tests	EUR 521

Mouse PRCP ELISA Kit
EMP0144	Abclonal	96Tests	EUR 521

Guinea pig Prolylcarboxypeptidase ELISA kit
E05P0137-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Prolylcarboxypeptidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Prolylcarboxypeptidase ELISA kit
E05P0137-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Prolylcarboxypeptidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Prolylcarboxypeptidase ELISA kit
E05P0137-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Prolylcarboxypeptidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea Pig PRCP ELISA Kit
EGP0144	Abclonal	96Tests	EUR 521

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

PRCP Recombinant Protein (Rat)
RP221936	ABM	100 ug	Ask for price

PRCP Antibody
31116-100ul	SAB	100ul	EUR 252

PRCP Antibody
31116-50ul	SAB	50ul	EUR 187

PRCP antibody
70R-19500	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal PRCP antibody

PRCP Antibody
1-CSB-PA921139	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PRCP. Recognizes PRCP from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

PRCP Antibody
1-CSB-PA241683	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PRCP. Recognizes PRCP from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

PRCP Antibody
1-CSB-PA018636GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PRCP. Recognizes PRCP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

PRCP Antibody
1-CSB-PA018636LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PRCP. Recognizes PRCP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

PRCP siRNA
20-abx929651	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PRCP siRNA
20-abx929652	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-PRCP
YF-PA13964	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to PRCP

anti-PRCP
YF-PA13965	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to PRCP

Prcp ORF Vector (Rat) (pORF)
ORF073980	ABM	1.0 ug DNA	EUR 506

Custom production of antibodies in 5 Rats using customer supplied antigen (std 63 days protocol)
RAT-5	Alpha Diagnostics	1	EUR 1138

PRCP Conjugated Antibody
C31116	SAB	100ul	EUR 397

PRCP cloning plasmid
CSB-CL018636HU-10ug	Cusabio	10ug	EUR 527
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1491 Sequence: atgggccgccgagccctcctgctcctgcttctgtcttttctggcgccctgggccaccatagccctccggccggccttaagggccctcggcagcctacacttgccaaccaaccccacatccctcccggctgtagccaagaactattcggttctctacttccaacagaaggttgatc Show more
Description: A cloning plasmid for the PRCP gene.

PRCP Rabbit pAb
A4040-100ul	Abclonal	100 ul	EUR 308

PRCP Rabbit pAb
A4040-200ul	Abclonal	200 ul	EUR 459

PRCP Rabbit pAb
A4040-20ul	Abclonal	20 ul	EUR 183

PRCP Rabbit pAb
A4040-50ul	Abclonal	50 ul	EUR 223

PRCP Polyclonal Antibody
A68663	EpiGentek	100 ?g	EUR 628.55
Description: Ask the seller for details

anti- PRCP antibody
FNab06751	FN Test	100µg	EUR 505.25
Immunogen: prolylcarboxypeptidase(angiotensinase C) Uniprot ID: P42785 Gene ID: 5547 Research Area: Cardiovascular, Metabolism
Description: Antibody raised against PRCP

Anti-PRCP antibody
PAab06751	Lifescience Market	100 ug	EUR 355

Anti-PRCP antibody
STJ25100	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the peptidase S28 family of serine exopeptidases. The encoded preproprotein is proteolytically processed to generate the mature lysosomal prolylcarboxypeptidase. This enzyme cleaves C-terminal amino acids linked to proline in peptides such as angiotension II, III and des-Arg9-bradykinin. The cleavage occurs at acidic pH, but the enzyme activity is retained with some substrates at neutral pH. This enzyme has been shown to be an activator of the cell matrix-associated prekallikrein. The importance of angiotension II, one of the substrates of this enzyme, in regulating blood pressure and electrolyte balance suggests that this gene may be related to essential hypertension. A pseudogene of this gene has been identified on chromosome 2. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed.

Anti-PRCP Antibody
STJ193169	St John's Laboratory	200 µl	EUR 197

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Prolylcarboxypeptidase (Angiotensinase C) Antibody
20-abx114719	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Rat PRCP(Prolylcarboxypeptidase) ELISA Equipment