Mouse VASN(Vasorin) ELISA Equipment
Mouse Vasorin (VASN) ELISA Kit |
RD-VASN-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 533 |
Mouse Vasorin (VASN) ELISA Kit |
RD-VASN-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
Human Vasorin (VASN) ELISA Kit |
DLR-VASN-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Vasorin (VASN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Vasorin (VASN) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Vasorin (VASN) ELISA Kit |
DLR-VASN-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Vasorin (VASN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Vasorin (VASN) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Vasorin (VASN) ELISA Kit |
RDR-VASN-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Vasorin (VASN) ELISA Kit |
RDR-VASN-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Vasorin (VASN) ELISA Kit |
RD-VASN-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Vasorin (VASN) ELISA Kit |
RD-VASN-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Mouse Vasorin (VASN) ELISA Kit |
20-abx154839 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Vasorin (VASN) ELISA Kit |
abx255015-96tests |
Abbexa |
96 tests |
EUR 746 |
- Shipped within 5-12 working days.
|
Mouse Vasn/ Vasorin ELISA Kit |
E1569Mo |
Sunlong |
1 Kit |
EUR 571 |
Mouse Vasorin (VASN) ELISA Kit |
abx571795-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Mouse Vasn(Vasorin) ELISA Kit |
EM0665 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: Q9CZT5
- Alias: Vasn/Protein slit-like 2/Atia/Slitl2/VASN/Protein slit-like 2/SLITL2/slit-like 2/slit-like 2(Drosophila)/vasorin
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.094 ng/ml |
Mouse Vasorin (VASN) ELISA Kit |
SEG905Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4862.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Vasorin (VASN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Vasorin (VASN) in Tissue homogenates and other biological fluids. |
Mouse Vasorin (VASN) ELISA Kit |
SEG905Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 488.08 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Vasorin (VASN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Vasorin (VASN) in Tissue homogenates and other biological fluids. |
Mouse Vasorin (VASN) ELISA Kit |
SEG905Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 654.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Vasorin (VASN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Vasorin (VASN) in Tissue homogenates and other biological fluids. |
Mouse Vasorin (VASN) ELISA Kit |
SEG905Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2644.8 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Vasorin (VASN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Vasorin (VASN) in Tissue homogenates and other biological fluids. |
Mouse Vasorin (VASN) ELISA Kit |
4-SEG905Mu |
Cloud-Clone |
-
EUR 4913.00
-
EUR 2595.00
-
EUR 655.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Vasorin elisa. Alternative names of the recognized antigen: SLITL2
- Slit-Like 2
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Vasorin (VASN) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
ELISA kit for Mouse VASN (Vasorin) |
ELK7122 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Vasorin (VASN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Vasorin (VASN). Nex
- Show more
|
Description: A sandwich ELISA kit for detection of Vasorin from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Mouse Vasorin (VASN) |
KTE70030-48T |
Abbkine |
48T |
EUR 332 |
- Vasodilator-stimulated phosphoprotein (VASP) is a member of the Ena-VASP protein family. Ena-VASP family members contain an EHV1 N-terminal domain that binds proteins containing E/DFPPPPXD/E motifs and targets Ena-VASP proteins to focal adhesions. In
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Vasorin (VASN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Vasorin (VASN) |
KTE70030-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Vasodilator-stimulated phosphoprotein (VASP) is a member of the Ena-VASP protein family. Ena-VASP family members contain an EHV1 N-terminal domain that binds proteins containing E/DFPPPPXD/E motifs and targets Ena-VASP proteins to focal adhesions. In
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Vasorin (VASN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Vasorin (VASN) |
KTE70030-96T |
Abbkine |
96T |
EUR 539 |
- Vasodilator-stimulated phosphoprotein (VASP) is a member of the Ena-VASP protein family. Ena-VASP family members contain an EHV1 N-terminal domain that binds proteins containing E/DFPPPPXD/E motifs and targets Ena-VASP proteins to focal adhesions. In
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Vasorin (VASN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Mouse Vasorin (VASN) CLIA Kit |
20-abx495325 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Mouse Vasorin (VASN) Protein |
20-abx167307 |
Abbexa |
-
EUR 690.00
-
EUR 286.00
-
EUR 2110.00
-
EUR 815.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Vasorin (VASN) ELISA Kit |
20-abx153457 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human VASN/ Vasorin ELISA Kit |
E2651Hu |
Sunlong |
1 Kit |
EUR 571 |
Human Vasorin (VASN) ELISA Kit |
abx572543-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Vasorin ELISA Kit (VASN) |
RK02486 |
Abclonal |
96 Tests |
EUR 521 |
Human Vasorin (VASN) ELISA Kit |
SEG905Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vasorin (VASN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vasorin (VASN) in tissue homogenates, cell lysates and other biological fluids. |
Human Vasorin (VASN) ELISA Kit |
SEG905Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vasorin (VASN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vasorin (VASN) in tissue homogenates, cell lysates and other biological fluids. |
Human Vasorin (VASN) ELISA Kit |
SEG905Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vasorin (VASN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vasorin (VASN) in tissue homogenates, cell lysates and other biological fluids. |
Human Vasorin (VASN) ELISA Kit |
SEG905Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vasorin (VASN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vasorin (VASN) in tissue homogenates, cell lysates and other biological fluids. |
Human Vasorin (VASN) ELISA Kit |
4-SEG905Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Vasorin elisa. Alternative names of the recognized antigen: SLITL2
- Slit-Like 2
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Vasorin (VASN) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Vasorin (VASN) Antibody |
20-abx178861 |
Abbexa |
|
|
|
Vasorin (VASN) Antibody |
20-abx128643 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Vasorin (VASN) Antibody |
20-abx129867 |
Abbexa |
-
EUR 314.00
-
EUR 133.00
-
EUR 829.00
-
EUR 439.00
-
EUR 272.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Vasorin (VASN) Antibody |
20-abx175081 |
Abbexa |
|
|
|
Vasorin (VASN) Antibody |
abx029986-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Vasorin (VASN) Antibody |
abx029986-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Recombinant Vasorin (VASN) |
4-RPG905Hu01 |
Cloud-Clone |
-
EUR 467.36
-
EUR 228.00
-
EUR 1477.60
-
EUR 559.20
-
EUR 1018.40
-
EUR 376.00
-
EUR 3544.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q6EMK4
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 29.8kDa
- Isoelectric Point: 8.7
|
Description: Recombinant Human Vasorin expressed in: E.coli |
Recombinant Vasorin (VASN) |
4-RPG905Mu01 |
Cloud-Clone |
-
EUR 490.66
-
EUR 234.00
-
EUR 1564.96
-
EUR 588.32
-
EUR 1076.64
-
EUR 391.00
-
EUR 3762.40
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q9CZT5
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 32.1kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Mouse Vasorin expressed in: E.coli |
Vasorin (VASN) Polyclonal Antibody (Mouse) |
4-PAG905Mu01 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2576.00
-
EUR 640.00
-
EUR 316.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: VASN (Asn299~Ala559)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Vasorin (VASN) |
ELISA kit for Human VASN (Vasorin) |
ELK3543 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Vasorin (VASN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Vasorin (VASN). Nex
- Show more
|
Description: A sandwich ELISA kit for detection of Vasorin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human Vasorin (VASN) |
KTE60072-48T |
Abbkine |
48T |
EUR 332 |
- The deduced 673-amino acid protein contains a putative hydrophobic signal sequence, 10 tandem arrays of a leucine-rich repeat, an epidermal growth factor-like domain, a fibronectin type III-like domain, and a short intracellular region. In situ hybri
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Vasorin (VASN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Vasorin (VASN) |
KTE60072-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- The deduced 673-amino acid protein contains a putative hydrophobic signal sequence, 10 tandem arrays of a leucine-rich repeat, an epidermal growth factor-like domain, a fibronectin type III-like domain, and a short intracellular region. In situ hybri
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Vasorin (VASN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Vasorin (VASN) |
KTE60072-96T |
Abbkine |
96T |
EUR 539 |
- The deduced 673-amino acid protein contains a putative hydrophobic signal sequence, 10 tandem arrays of a leucine-rich repeat, an epidermal growth factor-like domain, a fibronectin type III-like domain, and a short intracellular region. In situ hybri
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Vasorin (VASN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Human Vasorin (VASN) CLIA Kit |
20-abx495324 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Vasorin (VASN) Protein |
20-abx168095 |
Abbexa |
-
EUR 648.00
-
EUR 272.00
-
EUR 1998.00
-
EUR 773.00
-
EUR 467.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Vasorin (VASN) Polyclonal Antibody (Human, Mouse) |
4-PAG905Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: VASN (Asn298~Gly539)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Vasorin (VASN) |
Vasorin (VASN) Polyclonal Antibody (Mouse), APC |
4-PAG905Mu01-APC |
Cloud-Clone |
-
EUR 351.00
-
EUR 3365.00
-
EUR 935.00
-
EUR 449.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: VASN (Asn299~Ala559)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Vasorin (VASN). This antibody is labeled with APC. |
Vasorin (VASN) Polyclonal Antibody (Mouse), Biotinylated |
4-PAG905Mu01-Biotin |
Cloud-Clone |
-
EUR 316.00
-
EUR 2526.00
-
EUR 744.00
-
EUR 387.00
-
EUR 221.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: VASN (Asn299~Ala559)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Vasorin (VASN). This antibody is labeled with Biotin. |
Vasorin (VASN) Polyclonal Antibody (Mouse), Cy3 |
4-PAG905Mu01-Cy3 |
Cloud-Clone |
-
EUR 427.00
-
EUR 4445.00
-
EUR 1205.00
-
EUR 557.00
-
EUR 254.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: VASN (Asn299~Ala559)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Vasorin (VASN). This antibody is labeled with Cy3. |
Vasorin (VASN) Polyclonal Antibody (Mouse), FITC |
4-PAG905Mu01-FITC |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: VASN (Asn299~Ala559)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Vasorin (VASN). This antibody is labeled with FITC. |
Vasorin (VASN) Polyclonal Antibody (Mouse), HRP |
4-PAG905Mu01-HRP |
Cloud-Clone |
-
EUR 321.00
-
EUR 2933.00
-
EUR 827.00
-
EUR 405.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: VASN (Asn299~Ala559)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Vasorin (VASN). This antibody is labeled with HRP. |
Vasorin (VASN) Polyclonal Antibody (Mouse), PE |
4-PAG905Mu01-PE |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: VASN (Asn299~Ala559)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Vasorin (VASN). This antibody is labeled with PE. |
Vasorin (VASN) Polyclonal Antibody (Human, Mouse), APC |
4-PAG905Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: VASN (Asn298~Gly539)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Vasorin (VASN). This antibody is labeled with APC. |
Vasorin (VASN) Polyclonal Antibody (Human, Mouse), Biotinylated |
4-PAG905Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: VASN (Asn298~Gly539)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Vasorin (VASN). This antibody is labeled with Biotin. |
Vasorin (VASN) Polyclonal Antibody (Human, Mouse), Cy3 |
4-PAG905Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: VASN (Asn298~Gly539)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Vasorin (VASN). This antibody is labeled with Cy3. |
Vasorin (VASN) Polyclonal Antibody (Human, Mouse), FITC |
4-PAG905Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: VASN (Asn298~Gly539)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Vasorin (VASN). This antibody is labeled with FITC. |
Vasorin (VASN) Polyclonal Antibody (Human, Mouse), HRP |
4-PAG905Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: VASN (Asn298~Gly539)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Vasorin (VASN). This antibody is labeled with HRP. |
Vasorin (VASN) Polyclonal Antibody (Human, Mouse), PE |
4-PAG905Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: VASN (Asn298~Gly539)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Vasorin (VASN). This antibody is labeled with PE. |
Vasorin (VASN) Polyclonal Antibody (Mouse), APC-Cy7 |
4-PAG905Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 583.00
-
EUR 6610.00
-
EUR 1750.00
-
EUR 778.00
-
EUR 324.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: VASN (Asn299~Ala559)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Vasorin (VASN). This antibody is labeled with APC-Cy7. |
Human CellExp? Vasorin / VASN, Human recombinant |
P1134-10 |
Biovision |
|
EUR 142 |
Human CellExp? Vasorin / VASN, Human recombinant |
P1134-50 |
Biovision |
|
EUR 479 |
Vasorin (VASN) Polyclonal Antibody (Human, Mouse), APC-Cy7 |
4-PAG905Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: VASN (Asn298~Gly539)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Vasorin (VASN). This antibody is labeled with APC-Cy7. |
Recombinant Human Vasorin/SLITL2/VASN (C-6His) |
C394-10ug |
Novoprotein |
10ug |
EUR 156 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, 5% Threhalose, pH 7.2. |
Recombinant Human Vasorin/SLITL2/VASN (C-6His) |
C394-1mg |
Novoprotein |
1mg |
EUR 2283 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, 5% Threhalose, pH 7.2. |
Recombinant Human Vasorin/SLITL2/VASN (C-6His) |
C394-500ug |
Novoprotein |
500ug |
EUR 1613 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, 5% Threhalose, pH 7.2. |
Recombinant Human Vasorin/SLITL2/VASN (C-6His) |
C394-50ug |
Novoprotein |
50ug |
EUR 369 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, 5% Threhalose, pH 7.2. |
ELISA kit for Mouse Vasorin |
EK3852 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Vasorin in samples from serum, plasma, tissue homogenates and other biological fluids. |
ELISA kit for Human Vasorin |
EK3851 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Vasorin in samples from serum, plasma, tissue homogenates and other biological fluids. |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Mouse VASN shRNA Plasmid |
20-abx982806 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
VASN Recombinant Protein (Mouse) |
RP183656 |
ABM |
100 ug |
Ask for price |
VASN Antibody |
1-CSB-PA025796OA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against VASN. Recognizes VASN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:500-1:1000, IF:1:200-1:500 |
VASN siRNA |
20-abx939340 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
VASN siRNA |
20-abx939341 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Vasn ORF Vector (Mouse) (pORF) |
ORF061220 |
ABM |
1.0 ug DNA |
EUR 506 |
VASN Polyclonal Antibody |
29780-100ul |
SAB |
100ul |
EUR 252 |
VASN Polyclonal Antibody |
29780-50ul |
SAB |
50ul |
EUR 187 |
VASN Rabbit pAb |
A16215-100ul |
Abclonal |
100 ul |
EUR 308 |
VASN Rabbit pAb |
A16215-200ul |
Abclonal |
200 ul |
EUR 459 |
VASN Rabbit pAb |
A16215-20ul |
Abclonal |
20 ul |
EUR 183 |
VASN Rabbit pAb |
A16215-50ul |
Abclonal |
50 ul |
EUR 223 |
VASN cloning plasmid |
CSB-CL025796HU-10ug |
Cusabio |
10ug |
EUR 675 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2022
- Sequence: atgtgctccagggtccctctgctgctgccgctgctcctgctactggccctggggcctggggtgcagggctgcccatccggctgccagtgcagccagccacagacagtcttctgcactgcccgccaggggaccacggtgccccgagacgtgccacccgacacggtggggctgtacg
- Show more
|
Description: A cloning plasmid for the VASN gene. |
VASN Polyclonal Antibody |
ABP60871-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human VASN protein
- Applications tips:
|
Description: A polyclonal antibody for detection of VASN from Human, Mouse. This VASN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VASN protein |
VASN Polyclonal Antibody |
ABP60871-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human VASN protein
- Applications tips:
|
Description: A polyclonal antibody for detection of VASN from Human, Mouse. This VASN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VASN protein |
VASN Polyclonal Antibody |
ABP60871-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human VASN protein
- Applications tips:
|
Description: A polyclonal antibody for detection of VASN from Human, Mouse. This VASN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VASN protein |
VASN Polyclonal Antibody |
ES10988-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VASN from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
VASN Polyclonal Antibody |
ES10988-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VASN from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
Recombinant human VASN |
P1430 |
FN Test |
100ug |
Ask for price |
- Uniprot ID: Q6EMK4
- Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
|
Description: Recombinant protein for human VASN |
Anti-VASN antibody |
STJ192146 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to VASN |
Recombinant Human Vasorin Protein |
RP01087 |
Abclonal |
10 μg |
EUR 190 |
Vasn sgRNA CRISPR Lentivector set (Mouse) |
K4394901 |
ABM |
3 x 1.0 ug |
EUR 339 |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
VASN Antibody, HRP conjugated |
1-CSB-PA025796OB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against VASN. Recognizes VASN from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
VASN Antibody, FITC conjugated |
1-CSB-PA025796OC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against VASN. Recognizes VASN from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
VASN Antibody, Biotin conjugated |
1-CSB-PA025796OD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against VASN. Recognizes VASN from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Human VASN shRNA Plasmid |
20-abx964422 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
VASN Polyclonal Conjugated Antibody |
C29780 |
SAB |
100ul |
EUR 397 |
VASN Recombinant Protein (Rat) |
RP236282 |
ABM |
100 ug |
Ask for price |
VASN Recombinant Protein (Human) |
RP034255 |
ABM |
100 ug |
Ask for price |
Vasn sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4394902 |
ABM |
1.0 ug DNA |
EUR 154 |
Vasn sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4394903 |
ABM |
1.0 ug DNA |
EUR 154 |
Vasn sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4394904 |
ABM |
1.0 ug DNA |
EUR 154 |
VASN Protein Vector (Mouse) (pPB-C-His) |
PV244878 |
ABM |
500 ng |
EUR 1065 |
VASN Protein Vector (Mouse) (pPB-N-His) |
PV244879 |
ABM |
500 ng |
EUR 1065 |
VASN Protein Vector (Mouse) (pPM-C-HA) |
PV244880 |
ABM |
500 ng |
EUR 1065 |
VASN Protein Vector (Mouse) (pPM-C-His) |
PV244881 |
ABM |
500 ng |
EUR 1065 |
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV100PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV105PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV120PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV125PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS700A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS720A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS740A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents) |
CAS510A-KIT |
SBI |
1 Kit |
EUR 805 |
|
Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV200PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV205PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV220PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV225PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS750A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS770A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS790A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Mouse VASN(Vasorin) ELISA Equipment