Mouse SGSH(N-Sulfoglucosamine Sulfohydrolase) ELISA Equipment
Human N-Sulfoglucosamine Sulfohydrolase (SGSH) ELISA Kit |
RD-SGSH-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human N-Sulfoglucosamine Sulfohydrolase (SGSH) ELISA Kit |
RDR-SGSH-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human N-Sulfoglucosamine Sulfohydrolase (SGSH) ELISA Kit |
RDR-SGSH-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) ELISA Kit |
20-abx154672 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) ELISA Kit |
SEH178Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4862.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-As
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) in Tissue homogenates, cell lysates and other biological fluids. |
Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) ELISA Kit |
SEH178Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 488.08 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-As
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) in Tissue homogenates, cell lysates and other biological fluids. |
Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) ELISA Kit |
SEH178Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 654.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-As
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) in Tissue homogenates, cell lysates and other biological fluids. |
Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) ELISA Kit |
SEH178Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2644.8 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-As
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) in Tissue homogenates, cell lysates and other biological fluids. |
Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) ELISA Kit |
4-SEH178Mu |
Cloud-Clone |
-
EUR 4913.00
-
EUR 2595.00
-
EUR 655.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as N-Sulfoglucosamine Sulfohydrolase elisa. Alternative names of the recognized antigen: HSS
- MPS3A
- SFMD
- Sulfamidase
- Sulfoglucosamine sulfamidase
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
N-Sulfoglucosamine Sulfohydrolase (SGSH) Antibody |
20-abx131169 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
N-Sulfoglucosamine Sulfohydrolase (SGSH) Antibody |
abx122214-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
N-Sulfoglucosamine Sulfohydrolase (SGSH) Antibody |
20-abx005707 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
N-Sulfoglucosamine Sulfohydrolase (SGSH) Antibody |
20-abx173851 |
Abbexa |
|
|
|
N-Sulfoglucosamine Sulfohydrolase (SGSH) Antibody |
20-abx177828 |
Abbexa |
|
|
|
N-Sulfoglucosamine Sulfohydrolase (SGSH) Antibody |
20-abx177829 |
Abbexa |
|
|
|
N-Sulfoglucosamine Sulfohydrolase (SGSH) Antibody |
20-abx320539 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
N-Sulfoglucosamine Sulfohydrolase (SGSH) Antibody |
abx237813-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Recombinant N-Sulfoglucosamine Sulfohydrolase (SGSH) |
4-RPH178Hu01 |
Cloud-Clone |
-
EUR 462.88
-
EUR 227.00
-
EUR 1460.80
-
EUR 553.60
-
EUR 1007.20
-
EUR 373.00
-
EUR 3502.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P51688
- Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 71.1kDa
- Isoelectric Point: 7.1
|
Description: Recombinant Human N-Sulfoglucosamine Sulfohydrolase expressed in: E.coli |
Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) Protein |
20-abx654581 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) Protein |
20-abx654582 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) CLIA Kit |
20-abx495399 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human N-Sulfoglucosamine Sulfohydrolase (SGSH) ELISA Kit |
20-abx153076 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human N-Sulfoglucosamine Sulfohydrolase ELISA Kit (SGSH) |
RK02280 |
Abclonal |
96 Tests |
EUR 521 |
Human N-Sulfoglucosamine Sulfohydrolase (SGSH) ELISA Kit |
SEH178Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human N-Sulfoglucosamine Sulfohydrolase (SGSH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-As
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human N-Sulfoglucosamine Sulfohydrolase (SGSH) in Tissue homogenates, cell lysates and other biological fluids. |
Human N-Sulfoglucosamine Sulfohydrolase (SGSH) ELISA Kit |
SEH178Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human N-Sulfoglucosamine Sulfohydrolase (SGSH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-As
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human N-Sulfoglucosamine Sulfohydrolase (SGSH) in Tissue homogenates, cell lysates and other biological fluids. |
Human N-Sulfoglucosamine Sulfohydrolase (SGSH) ELISA Kit |
SEH178Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human N-Sulfoglucosamine Sulfohydrolase (SGSH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-As
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human N-Sulfoglucosamine Sulfohydrolase (SGSH) in Tissue homogenates, cell lysates and other biological fluids. |
Human N-Sulfoglucosamine Sulfohydrolase (SGSH) ELISA Kit |
SEH178Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human N-Sulfoglucosamine Sulfohydrolase (SGSH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-As
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human N-Sulfoglucosamine Sulfohydrolase (SGSH) in Tissue homogenates, cell lysates and other biological fluids. |
Human N-Sulfoglucosamine Sulfohydrolase (SGSH) ELISA Kit |
4-SEH178Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as N-Sulfoglucosamine Sulfohydrolase elisa. Alternative names of the recognized antigen: HSS
- MPS3A
- SFMD
- Sulfamidase
- Sulfoglucosamine sulfamidase
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human N-Sulfoglucosamine Sulfohydrolase (SGSH) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
ELISA kit for Mouse SGSH (N-Sulfoglucosamine Sulfohydrolase) |
ELK7260 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to N-Sulfoglucosamine Sulfohydrolase (SGSH). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody speci
- Show more
|
Description: A sandwich ELISA kit for detection of N-Sulfoglucosamine Sulfohydrolase from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Human N-Sulfoglucosamine Sulfohydrolase (SGSH) Protein |
20-abx650718 |
Abbexa |
-
EUR 648.00
-
EUR 272.00
-
EUR 1970.00
-
EUR 773.00
-
EUR 467.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
N-Sulfoglucosamine Sulfohydrolase (SGSH) Antibody (Biotin) |
20-abx274439 |
Abbexa |
-
EUR 453.00
-
EUR 244.00
-
EUR 1316.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human N-Sulfoglucosamine Sulfohydrolase (SGSH) CLIA Kit |
20-abx495398 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Human SGSH (N-Sulfoglucosamine Sulfohydrolase) |
ELK4165 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to N-Sulfoglucosamine Sulfohydrolase (SGSH). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody speci
- Show more
|
Description: A sandwich ELISA kit for detection of N-Sulfoglucosamine Sulfohydrolase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
N-Sulfoglucosamine Sulfohydrolase (SGSH) Polyclonal Antibody (Human) |
4-PAH178Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SGSH (Arg21~Asn389)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human N-Sulfoglucosamine Sulfohydrolase (SGSH) |
N-Sulfoglucosamine Sulfohydrolase (SGSH) Polyclonal Antibody (Human), APC |
4-PAH178Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SGSH (Arg21~Asn389)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human N-Sulfoglucosamine Sulfohydrolase (SGSH). This antibody is labeled with APC. |
N-Sulfoglucosamine Sulfohydrolase (SGSH) Polyclonal Antibody (Human), Biotinylated |
4-PAH178Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SGSH (Arg21~Asn389)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human N-Sulfoglucosamine Sulfohydrolase (SGSH). This antibody is labeled with Biotin. |
N-Sulfoglucosamine Sulfohydrolase (SGSH) Polyclonal Antibody (Human), Cy3 |
4-PAH178Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SGSH (Arg21~Asn389)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human N-Sulfoglucosamine Sulfohydrolase (SGSH). This antibody is labeled with Cy3. |
N-Sulfoglucosamine Sulfohydrolase (SGSH) Polyclonal Antibody (Human), FITC |
4-PAH178Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SGSH (Arg21~Asn389)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human N-Sulfoglucosamine Sulfohydrolase (SGSH). This antibody is labeled with FITC. |
N-Sulfoglucosamine Sulfohydrolase (SGSH) Polyclonal Antibody (Human), HRP |
4-PAH178Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SGSH (Arg21~Asn389)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human N-Sulfoglucosamine Sulfohydrolase (SGSH). This antibody is labeled with HRP. |
N-Sulfoglucosamine Sulfohydrolase (SGSH) Polyclonal Antibody (Human), PE |
4-PAH178Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SGSH (Arg21~Asn389)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human N-Sulfoglucosamine Sulfohydrolase (SGSH). This antibody is labeled with PE. |
N-Sulfoglucosamine Sulfohydrolase (SGSH) Polyclonal Antibody (Human), APC-Cy7 |
4-PAH178Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SGSH (Arg21~Asn389)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human N-Sulfoglucosamine Sulfohydrolase (SGSH). This antibody is labeled with APC-Cy7. |
N-Sulfoglucosamine Sulfohydrolase Antibody |
20-abx114157 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Human N- sulphoglucosamine sulphohydrolase, SGSH ELISA KIT |
ELI-39505h |
Lifescience Market |
96 Tests |
EUR 824 |
Human N-sulphoglucosamine sulphohydrolase(SGSH) ELISA kit |
CSB-EL021200HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human N-sulphoglucosamine sulphohydrolase (SGSH) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human N-sulphoglucosamine sulphohydrolase(SGSH) ELISA kit |
1-CSB-EL021200HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human N-sulphoglucosamine sulphohydrolase(SGSH) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
SGSH Protein Vector (Mouse) (pPB-N-His) |
PV228711 |
ABM |
500 ng |
EUR 603 |
SGSH Recombinant Protein (Mouse) |
RP171530 |
ABM |
100 ug |
Ask for price |
SGSH antibody |
22030-100ul |
SAB |
100ul |
EUR 390 |
SGSH antibody |
22031-100ul |
SAB |
100ul |
EUR 390 |
SGSH antibody |
70R-20229 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal SGSH antibody |
SGSH antibody |
70R-12598 |
Fitzgerald |
100 ul |
EUR 457 |
Description: Affinity purified Rabbit polyclonal SGSH antibody |
SGSH antibody |
70R-12599 |
Fitzgerald |
100 ul |
EUR 457 |
Description: Affinity purified Rabbit polyclonal SGSH antibody |
SGSH siRNA |
20-abx933183 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SGSH Antibody |
1-CSB-PA021200ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against SGSH. Recognizes SGSH from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
SGSH Antibody |
1-CSB-PA021200GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against SGSH. Recognizes SGSH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC |
anti-SGSH |
YF-PA14622 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to SGSH |
anti-SGSH |
YF-PA14623 |
Abfrontier |
100 ul |
EUR 403 |
Description: Rabbit polyclonal to SGSH |
anti-SGSH |
YF-PA14624 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to SGSH |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Sgsh ORF Vector (Mouse) (pORF) |
ORF057178 |
ABM |
1.0 ug DNA |
EUR 506 |
SGSH Protein Vector (Human) (pPB-N-His) |
PV037862 |
ABM |
500 ng |
EUR 329 |
Polyclonal SGSH Antibody |
APR13287G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SGSH . This antibody is tested and proven to work in the following applications: |
SGSH cloning plasmid |
CSB-CL021200HU-10ug |
Cusabio |
10ug |
EUR 532 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1509
- Sequence: atgagctgccccgtgcccgcctgctgcgcgctgctgctagtcctggggctctgccgggcgcgtccccggaacgcactgctgctcctcgcggatgacggaggctttgagagtggcgcgtacaacaacagcgccatcgccaccccgcacctggacgccttggcccgccgcagcctcc
- Show more
|
Description: A cloning plasmid for the SGSH gene. |
anti- SGSH antibody |
FNab07813 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:100
- Immunogen: N-sulfoglucosamine sulfohydrolase
- Uniprot ID: P51688
- Gene ID: 6448
- Research Area: Metabolism
|
Description: Antibody raised against SGSH |
SGSH Rabbit pAb |
A8148-100ul |
Abclonal |
100 ul |
EUR 308 |
SGSH Rabbit pAb |
A8148-200ul |
Abclonal |
200 ul |
EUR 459 |
SGSH Rabbit pAb |
A8148-20ul |
Abclonal |
20 ul |
EUR 183 |
SGSH Rabbit pAb |
A8148-50ul |
Abclonal |
50 ul |
EUR 223 |
SGSH Polyclonal Antibody |
31452-100ul |
SAB |
100ul |
EUR 252 |
SGSH Polyclonal Antibody |
31452-50ul |
SAB |
50ul |
EUR 187 |
Anti-SGSH antibody |
STJ110447 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes one of several enzymes involved in the lysosomal degradation of heparan sulfate. Mutations in this gene are associated with Sanfilippo syndrome A, one type of the lysosomal storage disease mucopolysaccaridosis III, which results from impaired degradation of heparan sulfate. Transcripts of varying sizes have been reported but their biological validity has not been determined. |
Recombinant Human N-Sulphoglucosamine Sulphohydrolase/SGSH (C-6His) |
CA15-10ug |
Novoprotein |
10ug |
EUR 202 |
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl,150mM NaCl,1mM GaCl2,10%Glycerol,pH7.5. |
Recombinant Human N-Sulphoglucosamine Sulphohydrolase/SGSH (C-6His) |
CA15-1mg |
Novoprotein |
1mg |
EUR 2283 |
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl,150mM NaCl,1mM GaCl2,10%Glycerol,pH7.5. |
Recombinant Human N-Sulphoglucosamine Sulphohydrolase/SGSH (C-6His) |
CA15-500ug |
Novoprotein |
500ug |
EUR 1613 |
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl,150mM NaCl,1mM GaCl2,10%Glycerol,pH7.5. |
Recombinant Human N-Sulphoglucosamine Sulphohydrolase/SGSH (C-6His) |
CA15-50ug |
Novoprotein |
50ug |
EUR 496 |
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl,150mM NaCl,1mM GaCl2,10%Glycerol,pH7.5. |
Sgsh sgRNA CRISPR Lentivector set (Mouse) |
K3681901 |
ABM |
3 x 1.0 ug |
EUR 339 |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
SGSH Polyclonal Conjugated Antibody |
C31452 |
SAB |
100ul |
EUR 397 |
Human SGSH shRNA Plasmid |
20-abx954359 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
SGSH Recombinant Protein (Human) |
RP028396 |
ABM |
100 ug |
Ask for price |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
Sgsh sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3681902 |
ABM |
1.0 ug DNA |
EUR 154 |
Sgsh sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3681903 |
ABM |
1.0 ug DNA |
EUR 154 |
Sgsh sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3681904 |
ABM |
1.0 ug DNA |
EUR 154 |
SGSH Protein Vector (Mouse) (pPB-C-His) |
PV228710 |
ABM |
500 ng |
EUR 603 |
SGSH Protein Vector (Mouse) (pPM-C-HA) |
PV228712 |
ABM |
500 ng |
EUR 603 |
SGSH Protein Vector (Mouse) (pPM-C-His) |
PV228713 |
ABM |
500 ng |
EUR 603 |
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
Polyclonal SGSH Antibody (C-Term) |
APR13288G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SGSH (C-Term). This antibody is tested and proven to work in the following applications: |
SGSH ORF Vector (Human) (pORF) |
ORF009466 |
ABM |
1.0 ug DNA |
EUR 95 |
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV100PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV105PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV120PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV125PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS700A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS720A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS740A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents) |
CAS510A-KIT |
SBI |
1 Kit |
EUR 805 |
|
Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV200PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV205PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV220PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV225PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS750A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS770A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS790A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)] |
CAS9LIG-KIT |
SBI |
1 Kit |
EUR 153 |
|
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN320A-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN340iPS-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
Recombinant 2019-nCoV N protein |
N-127V |
Creative-Biomart |
100ug |
EUR 1610 |
|
Description: Recombinant 2019-nCoV N protein was expressed in E. coli and purified by Ni column.; Coronaviruses have positive-sense RNA genome and a nucleocapsid of helical symmetry.Coronavirus N protein is required for coronavirus RNA synthesis, and has RNA chaperone activity that may be involved in template switch.N protein of coronavirus is chosen as a diagnostic tool. |
SGSH sgRNA CRISPR Lentivector set (Human) |
K2137801 |
ABM |
3 x 1.0 ug |
EUR 339 |
AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE620A-KIT |
SBI |
1 kit |
EUR 2132 |
|
AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE622A-KIT |
SBI |
1 kit |
EUR 2132 |
|
AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE624A-KIT |
SBI |
1 kit |
EUR 2132 |
|
N-AcetyIneuraminic Acid, Sialic acid; NANA; Neu5Ac |
SLA15-N |
Alpha Diagnostics |
5 mg |
EUR 164 |
vWF Acty. Kit |
ABP-ACT-KIT |
Abpcorp |
12 x 8 microwells |
EUR 428 |
vWF Ant. Kit |
ABP-TOT-KIT |
Abpcorp |
12 x 8 microwells |
EUR 394 |
Sgsh sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse) |
K3681905 |
ABM |
3 x 1.0 ug |
EUR 376 |
SGSH sgRNA CRISPR Lentivector (Human) (Target 1) |
K2137802 |
ABM |
1.0 ug DNA |
EUR 154 |
SGSH sgRNA CRISPR Lentivector (Human) (Target 2) |
K2137803 |
ABM |
1.0 ug DNA |
EUR 154 |
SGSH sgRNA CRISPR Lentivector (Human) (Target 3) |
K2137804 |
ABM |
1.0 ug DNA |
EUR 154 |
SGSH Protein Vector (Human) (pPB-C-His) |
PV037861 |
ABM |
500 ng |
EUR 329 |
SGSH Protein Vector (Human) (pPM-C-HA) |
PV037863 |
ABM |
500 ng |
EUR 329 |
SGSH Protein Vector (Human) (pPM-C-His) |
PV037864 |
ABM |
500 ng |
EUR 329 |
Sgsh 3'UTR GFP Stable Cell Line |
TU168728 |
ABM |
1.0 ml |
Ask for price |
SGSH 3'UTR Luciferase Stable Cell Line |
TU023075 |
ABM |
1.0 ml |
EUR 1394 |
Sgsh 3'UTR Luciferase Stable Cell Line |
TU118728 |
ABM |
1.0 ml |
Ask for price |
SGSH 3'UTR GFP Stable Cell Line |
TU073075 |
ABM |
1.0 ml |
EUR 1394 |
hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9) |
CAS620A-KIT |
SBI |
1 kit |
EUR 2152 |
|
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression) |
PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN300A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN400A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN410A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN412A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
PrecisionX Multiplex gRNA Cloning Kit |
CAS9-GRNA-KIT |
SBI |
10 rxn |
EUR 445 |
|
Mouse SGSH(N-Sulfoglucosamine Sulfohydrolase) ELISA Equipment