Mouse SGSH(N-Sulfoglucosamine Sulfohydrolase) ELISA Kit

Mouse SGSH(N-Sulfoglucosamine Sulfohydrolase) ELISA Equipment

Human N-Sulfoglucosamine Sulfohydrolase (SGSH) ELISA Kit
RD-SGSH-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human N-Sulfoglucosamine Sulfohydrolase (SGSH) ELISA Kit
RDR-SGSH-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human N-Sulfoglucosamine Sulfohydrolase (SGSH) ELISA Kit
RDR-SGSH-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) ELISA Kit
20-abx154672	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) ELISA Kit
SEH178Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4862.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-As Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) in Tissue homogenates, cell lysates and other biological fluids.

Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) ELISA Kit
SEH178Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 488.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-As Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) in Tissue homogenates, cell lysates and other biological fluids.

Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) ELISA Kit
SEH178Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 654.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-As Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) in Tissue homogenates, cell lysates and other biological fluids.

Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) ELISA Kit
SEH178Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2644.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-As Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) in Tissue homogenates, cell lysates and other biological fluids.

Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) ELISA Kit
4-SEH178Mu	Cloud-Clone	EUR 4913.00 EUR 2595.00 EUR 655.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as N-Sulfoglucosamine Sulfohydrolase elisa. Alternative names of the recognized antigen: HSS MPS3A SFMD Sulfamidase Sulfoglucosamine sulfamidase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

N-Sulfoglucosamine Sulfohydrolase (SGSH) Antibody
20-abx131169	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

N-Sulfoglucosamine Sulfohydrolase (SGSH) Antibody
abx122214-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

N-Sulfoglucosamine Sulfohydrolase (SGSH) Antibody
20-abx005707	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

N-Sulfoglucosamine Sulfohydrolase (SGSH) Antibody
20-abx173851	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

N-Sulfoglucosamine Sulfohydrolase (SGSH) Antibody
20-abx177828	Abbexa	EUR 1233.00 EUR 592.00	1 mg 200 ug
Please enquire.

N-Sulfoglucosamine Sulfohydrolase (SGSH) Antibody
20-abx177829	Abbexa	EUR 1233.00 EUR 592.00	1 mg 200 ug
Please enquire.

N-Sulfoglucosamine Sulfohydrolase (SGSH) Antibody
20-abx320539	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

N-Sulfoglucosamine Sulfohydrolase (SGSH) Antibody
abx237813-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Recombinant N-Sulfoglucosamine Sulfohydrolase (SGSH)
4-RPH178Hu01	Cloud-Clone	EUR 462.88 EUR 227.00 EUR 1460.80 EUR 553.60 EUR 1007.20 EUR 373.00 EUR 3502.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P51688 Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 71.1kDa Isoelectric Point: 7.1
Description: Recombinant Human N-Sulfoglucosamine Sulfohydrolase expressed in: E.coli

Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) Protein
20-abx654581	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) Protein
20-abx654582	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) CLIA Kit
20-abx495399	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human N-Sulfoglucosamine Sulfohydrolase (SGSH) ELISA Kit
20-abx153076	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human N-Sulfoglucosamine Sulfohydrolase ELISA Kit (SGSH)
RK02280	Abclonal	96 Tests	EUR 521

Human N-Sulfoglucosamine Sulfohydrolase (SGSH) ELISA Kit
SEH178Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human N-Sulfoglucosamine Sulfohydrolase (SGSH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-As Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human N-Sulfoglucosamine Sulfohydrolase (SGSH) in Tissue homogenates, cell lysates and other biological fluids.

Human N-Sulfoglucosamine Sulfohydrolase (SGSH) ELISA Kit
SEH178Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human N-Sulfoglucosamine Sulfohydrolase (SGSH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-As Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human N-Sulfoglucosamine Sulfohydrolase (SGSH) in Tissue homogenates, cell lysates and other biological fluids.

Human N-Sulfoglucosamine Sulfohydrolase (SGSH) ELISA Kit
SEH178Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human N-Sulfoglucosamine Sulfohydrolase (SGSH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-As Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human N-Sulfoglucosamine Sulfohydrolase (SGSH) in Tissue homogenates, cell lysates and other biological fluids.

Human N-Sulfoglucosamine Sulfohydrolase (SGSH) ELISA Kit
SEH178Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human N-Sulfoglucosamine Sulfohydrolase (SGSH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-As Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human N-Sulfoglucosamine Sulfohydrolase (SGSH) in Tissue homogenates, cell lysates and other biological fluids.

Human N-Sulfoglucosamine Sulfohydrolase (SGSH) ELISA Kit
4-SEH178Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as N-Sulfoglucosamine Sulfohydrolase elisa. Alternative names of the recognized antigen: HSS MPS3A SFMD Sulfamidase Sulfoglucosamine sulfamidase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human N-Sulfoglucosamine Sulfohydrolase (SGSH) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Mouse SGSH (N-Sulfoglucosamine Sulfohydrolase)
ELK7260	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to N-Sulfoglucosamine Sulfohydrolase (SGSH). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody speci Show more
Description: A sandwich ELISA kit for detection of N-Sulfoglucosamine Sulfohydrolase from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human N-Sulfoglucosamine Sulfohydrolase (SGSH) Protein
20-abx650718	Abbexa	EUR 648.00 EUR 272.00 EUR 1970.00 EUR 773.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

N-Sulfoglucosamine Sulfohydrolase (SGSH) Antibody (Biotin)
20-abx274439	Abbexa	EUR 453.00 EUR 244.00 EUR 1316.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human N-Sulfoglucosamine Sulfohydrolase (SGSH) CLIA Kit
20-abx495398	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human SGSH (N-Sulfoglucosamine Sulfohydrolase)
ELK4165	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to N-Sulfoglucosamine Sulfohydrolase (SGSH). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody speci Show more
Description: A sandwich ELISA kit for detection of N-Sulfoglucosamine Sulfohydrolase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

N-Sulfoglucosamine Sulfohydrolase (SGSH) Polyclonal Antibody (Human)
4-PAH178Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SGSH (Arg21~Asn389) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human N-Sulfoglucosamine Sulfohydrolase (SGSH)

N-Sulfoglucosamine Sulfohydrolase (SGSH) Polyclonal Antibody (Human), APC
4-PAH178Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SGSH (Arg21~Asn389) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human N-Sulfoglucosamine Sulfohydrolase (SGSH). This antibody is labeled with APC.

N-Sulfoglucosamine Sulfohydrolase (SGSH) Polyclonal Antibody (Human), Biotinylated
4-PAH178Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SGSH (Arg21~Asn389) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human N-Sulfoglucosamine Sulfohydrolase (SGSH). This antibody is labeled with Biotin.

N-Sulfoglucosamine Sulfohydrolase (SGSH) Polyclonal Antibody (Human), Cy3
4-PAH178Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SGSH (Arg21~Asn389) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human N-Sulfoglucosamine Sulfohydrolase (SGSH). This antibody is labeled with Cy3.

N-Sulfoglucosamine Sulfohydrolase (SGSH) Polyclonal Antibody (Human), FITC
4-PAH178Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SGSH (Arg21~Asn389) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human N-Sulfoglucosamine Sulfohydrolase (SGSH). This antibody is labeled with FITC.

N-Sulfoglucosamine Sulfohydrolase (SGSH) Polyclonal Antibody (Human), HRP
4-PAH178Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SGSH (Arg21~Asn389) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human N-Sulfoglucosamine Sulfohydrolase (SGSH). This antibody is labeled with HRP.

N-Sulfoglucosamine Sulfohydrolase (SGSH) Polyclonal Antibody (Human), PE
4-PAH178Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SGSH (Arg21~Asn389) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human N-Sulfoglucosamine Sulfohydrolase (SGSH). This antibody is labeled with PE.

N-Sulfoglucosamine Sulfohydrolase (SGSH) Polyclonal Antibody (Human), APC-Cy7
4-PAH178Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SGSH (Arg21~Asn389) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human N-Sulfoglucosamine Sulfohydrolase (SGSH). This antibody is labeled with APC-Cy7.

N-Sulfoglucosamine Sulfohydrolase Antibody
20-abx114157	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Human N- sulphoglucosamine sulphohydrolase, SGSH ELISA KIT
ELI-39505h	Lifescience Market	96 Tests	EUR 824

Human N-sulphoglucosamine sulphohydrolase(SGSH) ELISA kit
CSB-EL021200HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human N-sulphoglucosamine sulphohydrolase (SGSH) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human N-sulphoglucosamine sulphohydrolase(SGSH) ELISA kit
1-CSB-EL021200HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human N-sulphoglucosamine sulphohydrolase(SGSH) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

SGSH ELISA KIT|Human
EF002885	Lifescience Market	96 Tests	EUR 689

SGSH Protein Vector (Mouse) (pPB-N-His)
PV228711	ABM	500 ng	EUR 603

SGSH Recombinant Protein (Mouse)
RP171530	ABM	100 ug	Ask for price

SGSH antibody
22030-100ul	SAB	100ul	EUR 390

SGSH antibody
22031-100ul	SAB	100ul	EUR 390

SGSH antibody
70R-20229	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal SGSH antibody

SGSH antibody
70R-12598	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal SGSH antibody

SGSH antibody
70R-12599	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal SGSH antibody

SGSH siRNA
20-abx933183	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SGSH Antibody
1-CSB-PA021200ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SGSH. Recognizes SGSH from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

SGSH Antibody
1-CSB-PA021200GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SGSH. Recognizes SGSH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

anti-SGSH
YF-PA14622	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to SGSH

anti-SGSH
YF-PA14623	Abfrontier	100 ul	EUR 403
Description: Rabbit polyclonal to SGSH

anti-SGSH
YF-PA14624	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to SGSH

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Sgsh ORF Vector (Mouse) (pORF)
ORF057178	ABM	1.0 ug DNA	EUR 506

SGSH Protein Vector (Human) (pPB-N-His)
PV037862	ABM	500 ng	EUR 329

Polyclonal SGSH Antibody
APR13287G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SGSH . This antibody is tested and proven to work in the following applications:

SGSH cloning plasmid
CSB-CL021200HU-10ug	Cusabio	10ug	EUR 532
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1509 Sequence: atgagctgccccgtgcccgcctgctgcgcgctgctgctagtcctggggctctgccgggcgcgtccccggaacgcactgctgctcctcgcggatgacggaggctttgagagtggcgcgtacaacaacagcgccatcgccaccccgcacctggacgccttggcccgccgcagcctcc Show more
Description: A cloning plasmid for the SGSH gene.

anti- SGSH antibody
FNab07813	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:100 Immunogen: N-sulfoglucosamine sulfohydrolase Uniprot ID: P51688 Gene ID: 6448 Research Area: Metabolism
Description: Antibody raised against SGSH

SGSH Rabbit pAb
A8148-100ul	Abclonal	100 ul	EUR 308

SGSH Rabbit pAb
A8148-200ul	Abclonal	200 ul	EUR 459

SGSH Rabbit pAb
A8148-20ul	Abclonal	20 ul	EUR 183

SGSH Rabbit pAb
A8148-50ul	Abclonal	50 ul	EUR 223

SGSH Polyclonal Antibody
31452-100ul	SAB	100ul	EUR 252

SGSH Polyclonal Antibody
31452-50ul	SAB	50ul	EUR 187

Anti-SGSH antibody
PAab07813	Lifescience Market	100 ug	EUR 355

pCMV-SPORT6-SGSH
PVT19125	Lifescience Market	2 ug	EUR 231

Anti-SGSH antibody
STJ110447	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes one of several enzymes involved in the lysosomal degradation of heparan sulfate. Mutations in this gene are associated with Sanfilippo syndrome A, one type of the lysosomal storage disease mucopolysaccaridosis III, which results from impaired degradation of heparan sulfate. Transcripts of varying sizes have been reported but their biological validity has not been determined.

Recombinant Human N-Sulphoglucosamine Sulphohydrolase/SGSH (C-6His)
CA15-10ug	Novoprotein	10ug	EUR 202
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl,150mM NaCl,1mM GaCl2,10%Glycerol,pH7.5.

Recombinant Human N-Sulphoglucosamine Sulphohydrolase/SGSH (C-6His)
CA15-1mg	Novoprotein	1mg	EUR 2283
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl,150mM NaCl,1mM GaCl2,10%Glycerol,pH7.5.

Recombinant Human N-Sulphoglucosamine Sulphohydrolase/SGSH (C-6His)
CA15-500ug	Novoprotein	500ug	EUR 1613
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl,150mM NaCl,1mM GaCl2,10%Glycerol,pH7.5.

Recombinant Human N-Sulphoglucosamine Sulphohydrolase/SGSH (C-6His)
CA15-50ug	Novoprotein	50ug	EUR 496
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl,150mM NaCl,1mM GaCl2,10%Glycerol,pH7.5.

Sgsh sgRNA CRISPR Lentivector set (Mouse)
K3681901	ABM	3 x 1.0 ug	EUR 339

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

SGSH Polyclonal Conjugated Antibody
C31452	SAB	100ul	EUR 397

Human SGSH shRNA Plasmid
20-abx954359	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

SGSH Recombinant Protein (Human)
RP028396	ABM	100 ug	Ask for price

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

N-Acetylglucosamine
NAG15-N	Alpha Diagnostics	1 g	EUR 286

Sgsh sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3681902	ABM	1.0 ug DNA	EUR 154

Sgsh sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3681903	ABM	1.0 ug DNA	EUR 154

Sgsh sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3681904	ABM	1.0 ug DNA	EUR 154

SGSH Protein Vector (Mouse) (pPB-C-His)
PV228710	ABM	500 ng	EUR 603

SGSH Protein Vector (Mouse) (pPM-C-HA)
PV228712	ABM	500 ng	EUR 603

SGSH Protein Vector (Mouse) (pPM-C-His)
PV228713	ABM	500 ng	EUR 603

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

Polyclonal SGSH Antibody (C-Term)
APR13288G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SGSH (C-Term). This antibody is tested and proven to work in the following applications:

SGSH ORF Vector (Human) (pORF)
ORF009466	ABM	1.0 ug DNA	EUR 95

pECMV-Sgsh-m-FLAG Plasmid
PVT15005	Lifescience Market	2 ug	EUR 325

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
CAS9LIG-KIT	SBI	1 Kit	EUR 153
Category: Cas9

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

Recombinant 2019-nCoV N protein
N-127V	Creative-Biomart	100ug	EUR 1610
Concentration 1.0 mg/ml
Description: Recombinant 2019-nCoV N protein was expressed in E. coli and purified by Ni column.; Coronaviruses have positive-sense RNA genome and a nucleocapsid of helical symmetry.Coronavirus N protein is required for coronavirus RNA synthesis, and has RNA chaperone activity that may be involved in template switch.N protein of coronavirus is chosen as a diagnostic tool.

SGSH sgRNA CRISPR Lentivector set (Human)
K2137801	ABM	3 x 1.0 ug	EUR 339

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE620A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE622A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE624A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

N-AcetyIneuraminic Acid, Sialic acid; NANA; Neu5Ac
SLA15-N	Alpha Diagnostics	5 mg	EUR 164

vWF Acty. Kit
ABP-ACT-KIT	Abpcorp	12 x 8 microwells	EUR 428

vWF Ant. Kit
ABP-TOT-KIT	Abpcorp	12 x 8 microwells	EUR 394

Sgsh sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3681905	ABM	3 x 1.0 ug	EUR 376

SGSH sgRNA CRISPR Lentivector (Human) (Target 1)
K2137802	ABM	1.0 ug DNA	EUR 154

SGSH sgRNA CRISPR Lentivector (Human) (Target 2)
K2137803	ABM	1.0 ug DNA	EUR 154

SGSH sgRNA CRISPR Lentivector (Human) (Target 3)
K2137804	ABM	1.0 ug DNA	EUR 154

SGSH Protein Vector (Human) (pPB-C-His)
PV037861	ABM	500 ng	EUR 329

SGSH Protein Vector (Human) (pPM-C-HA)
PV037863	ABM	500 ng	EUR 329

SGSH Protein Vector (Human) (pPM-C-His)
PV037864	ABM	500 ng	EUR 329

Sgsh 3'UTR GFP Stable Cell Line
TU168728	ABM	1.0 ml	Ask for price

SGSH 3'UTR Luciferase Stable Cell Line
TU023075	ABM	1.0 ml	EUR 1394

Sgsh 3'UTR Luciferase Stable Cell Line
TU118728	ABM	1.0 ml	Ask for price

SGSH 3'UTR GFP Stable Cell Line
TU073075	ABM	1.0 ml	EUR 1394

hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)
CAS620A-KIT	SBI	1 kit	EUR 2152
Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PrecisionX Multiplex gRNA Cloning Kit
CAS9-GRNA-KIT	SBI	10 rxn	EUR 445
Category: Cas9

Mouse SGSH(N-Sulfoglucosamine Sulfohydrolase) ELISA Equipment