Mouse SGSH(N-Sulfoglucosamine Sulfohydrolase) ELISA Kit

Mouse SGSH(N-Sulfoglucosamine Sulfohydrolase) ELISA Equipment

Human N-Sulfoglucosamine Sulfohydrolase (SGSH) ELISA Kit

RD-SGSH-Hu-96Tests 96 Tests
EUR 723

Human N-Sulfoglucosamine Sulfohydrolase (SGSH) ELISA Kit

RDR-SGSH-Hu-48Tests 48 Tests
EUR 544

Human N-Sulfoglucosamine Sulfohydrolase (SGSH) ELISA Kit

RDR-SGSH-Hu-96Tests 96 Tests
EUR 756

Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) ELISA Kit

SEH178Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-As
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) in Tissue homogenates, cell lysates and other biological fluids.

Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) ELISA Kit

SEH178Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-As
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) in Tissue homogenates, cell lysates and other biological fluids.

Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) ELISA Kit

SEH178Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-As
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) in Tissue homogenates, cell lysates and other biological fluids.

Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) ELISA Kit

SEH178Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-As
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) in Tissue homogenates, cell lysates and other biological fluids.

Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) ELISA Kit

  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as N-Sulfoglucosamine Sulfohydrolase elisa. Alternative names of the recognized antigen: HSS
  • MPS3A
  • SFMD
  • Sulfamidase
  • Sulfoglucosamine sulfamidase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

N-Sulfoglucosamine Sulfohydrolase (SGSH) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

N-Sulfoglucosamine Sulfohydrolase (SGSH) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

N-Sulfoglucosamine Sulfohydrolase (SGSH) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

N-Sulfoglucosamine Sulfohydrolase (SGSH) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

N-Sulfoglucosamine Sulfohydrolase (SGSH) Antibody

abx122214-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

N-Sulfoglucosamine Sulfohydrolase (SGSH) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

N-Sulfoglucosamine Sulfohydrolase (SGSH) Antibody

abx237813-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

N-Sulfoglucosamine Sulfohydrolase (SGSH) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Recombinant N-Sulfoglucosamine Sulfohydrolase (SGSH)

  • EUR 462.88
  • EUR 227.00
  • EUR 1460.80
  • EUR 553.60
  • EUR 1007.20
  • EUR 373.00
  • EUR 3502.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P51688
  • Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 71.1kDa
  • Isoelectric Point: 7.1
Description: Recombinant Human N-Sulfoglucosamine Sulfohydrolase expressed in: E.coli

Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mouse N-Sulfoglucosamine Sulfohydrolase (SGSH) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human N-Sulfoglucosamine Sulfohydrolase (SGSH) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human N-Sulfoglucosamine Sulfohydrolase ELISA Kit (SGSH)

RK02280 96 Tests
EUR 521

Human N-Sulfoglucosamine Sulfohydrolase (SGSH) ELISA Kit

SEH178Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human N-Sulfoglucosamine Sulfohydrolase (SGSH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-As
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human N-Sulfoglucosamine Sulfohydrolase (SGSH) in Tissue homogenates, cell lysates and other biological fluids.

Human N-Sulfoglucosamine Sulfohydrolase (SGSH) ELISA Kit

SEH178Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human N-Sulfoglucosamine Sulfohydrolase (SGSH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-As
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human N-Sulfoglucosamine Sulfohydrolase (SGSH) in Tissue homogenates, cell lysates and other biological fluids.

Human N-Sulfoglucosamine Sulfohydrolase (SGSH) ELISA Kit

SEH178Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human N-Sulfoglucosamine Sulfohydrolase (SGSH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-As
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human N-Sulfoglucosamine Sulfohydrolase (SGSH) in Tissue homogenates, cell lysates and other biological fluids.

Human N-Sulfoglucosamine Sulfohydrolase (SGSH) ELISA Kit

SEH178Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human N-Sulfoglucosamine Sulfohydrolase (SGSH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-As
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human N-Sulfoglucosamine Sulfohydrolase (SGSH) in Tissue homogenates, cell lysates and other biological fluids.

Human N-Sulfoglucosamine Sulfohydrolase (SGSH) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as N-Sulfoglucosamine Sulfohydrolase elisa. Alternative names of the recognized antigen: HSS
  • MPS3A
  • SFMD
  • Sulfamidase
  • Sulfoglucosamine sulfamidase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human N-Sulfoglucosamine Sulfohydrolase (SGSH) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Mouse SGSH (N-Sulfoglucosamine Sulfohydrolase)

ELK7260 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to N-Sulfoglucosamine Sulfohydrolase (SGSH). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody speci
  • Show more
Description: A sandwich ELISA kit for detection of N-Sulfoglucosamine Sulfohydrolase from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human N-Sulfoglucosamine Sulfohydrolase (SGSH) Protein

  • EUR 648.00
  • EUR 272.00
  • EUR 1970.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

N-Sulfoglucosamine Sulfohydrolase (SGSH) Antibody (Biotin)

  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human N-Sulfoglucosamine Sulfohydrolase (SGSH) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human SGSH (N-Sulfoglucosamine Sulfohydrolase)

ELK4165 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to N-Sulfoglucosamine Sulfohydrolase (SGSH). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody speci
  • Show more
Description: A sandwich ELISA kit for detection of N-Sulfoglucosamine Sulfohydrolase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

N-Sulfoglucosamine Sulfohydrolase (SGSH) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SGSH (Arg21~Asn389)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human N-Sulfoglucosamine Sulfohydrolase (SGSH)

N-Sulfoglucosamine Sulfohydrolase (SGSH) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SGSH (Arg21~Asn389)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human N-Sulfoglucosamine Sulfohydrolase (SGSH). This antibody is labeled with APC.

N-Sulfoglucosamine Sulfohydrolase (SGSH) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SGSH (Arg21~Asn389)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human N-Sulfoglucosamine Sulfohydrolase (SGSH). This antibody is labeled with Biotin.

N-Sulfoglucosamine Sulfohydrolase (SGSH) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SGSH (Arg21~Asn389)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human N-Sulfoglucosamine Sulfohydrolase (SGSH). This antibody is labeled with Cy3.

N-Sulfoglucosamine Sulfohydrolase (SGSH) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SGSH (Arg21~Asn389)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human N-Sulfoglucosamine Sulfohydrolase (SGSH). This antibody is labeled with FITC.

N-Sulfoglucosamine Sulfohydrolase (SGSH) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SGSH (Arg21~Asn389)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human N-Sulfoglucosamine Sulfohydrolase (SGSH). This antibody is labeled with HRP.

N-Sulfoglucosamine Sulfohydrolase (SGSH) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SGSH (Arg21~Asn389)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human N-Sulfoglucosamine Sulfohydrolase (SGSH). This antibody is labeled with PE.

N-Sulfoglucosamine Sulfohydrolase (SGSH) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SGSH (Arg21~Asn389)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human N-Sulfoglucosamine Sulfohydrolase (SGSH). This antibody is labeled with APC-Cy7.

N-Sulfoglucosamine Sulfohydrolase Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

SGSH ELISA Kit (Mouse) (OKCD04211)

OKCD04211 96 Wells
EUR 857
Description: Description of target: ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.053 ng/mL

Human N-sulphoglucosamine sulphohydrolase(SGSH) ELISA kit

CSB-EL021200HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human N-sulphoglucosamine sulphohydrolase (SGSH) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human N-sulphoglucosamine sulphohydrolase(SGSH) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human N-sulphoglucosamine sulphohydrolase(SGSH) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human N- sulphoglucosamine sulphohydrolase, SGSH ELISA KIT

ELI-39505h 96 Tests
EUR 824


EF002885 96 Tests
EUR 689

SGSH Protein Vector (Mouse) (pPB-N-His)

PV228711 500 ng
EUR 603

SGSH ELISA Kit (Human) (OKAN06141)

OKAN06141 96 Wells
EUR 792
Description: Description of target: This gene encodes the enzyme sulfamidase; one of several enzymes involved in the lysosomal degradation of heparan sulfate. Mutations in this gene are associated with the lysosomal storage disease mucopolysaccaridosis IIIA, also known as Sanfilippo syndrome A, which results from impaired degradation of heparan sulfate. Transcripts of varying sizes have been reported but their biological validity has not been determined.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.054 ng/mL

SGSH ELISA Kit (Human) (OKCD00525)

OKCD00525 96 Wells
EUR 831
Description: Description of target: Catalyzes a step in lysosomal heparan sulfate degradation.3 Publications <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.1"Cloning of the sulphamidase gene and identification of mutations in Sanfilippo A syndrome."_x005F_x005F_x000D_Scott H.S., Blanch L., Guo X.-H., Freeman C., Orsborn A., Baker E., Sutherland G.R., Morris C.P., Hopwood J.J._x005F_x005F_x000D_Nat. Genet. 11:465-467(1995) [PubMed] [Europe PMC] [Abstract]Cited for: NUCLEOTIDE SEQUENCE [MRNA], PROTEIN SEQUENCE OF 21-45, CATALYTIC ACTIVITY, FUNCTION.Ref.8"Structure of sulfamidase provides insight into the molecular pathology of mucopolysaccharidosis IIIA."_x005F_x005F_x000D_Sidhu N.S., Schreiber K., Propper K., Becker S., Uson I., Sheldrick G.M., Gartner J., Kratzner R., Steinfeld R._x005F_x005F_x000D_Acta Crystallogr. D 70:1321-1335(2014) [PubMed] [Europe PMC] [Abstract]Cited for: X-RAY CRYSTALLOGRAPHY (2.00 ANGSTROMS) IN COMPLEX WITH CALCIUM, FUNCTION, CATALYTIC ACTIVITY, GLYCOSYLATION AT ASN-41; ASN-151; ASN-264 AND ASN-413, DISULFIDE BONDS, FORMYLGLYCINE.Ref.18"Transport, enzymatic activity, and stability of mutant sulfamidase (SGSH) identified in patients with mucopolysaccharidosis type III A."_x005F_x005F_x000D_Muschol N., Storch S., Ballhausen D., Beesley C., Westermann J.-C., Gal A., Ullrich K., Hopwood J.J., Winchester B., Braulke T._x005F_x005F_x000D_Hum. Mutat. 23:559-566(2004) [PubMed] [Europe PMC] [Abstract]Cited for: VARIANTS MPS3A CYS-74; ARG-106; PRO-163; ARG-191; TYR-403 DEL AND TRP-433, CHARACTERIZATION OF VARIANTS MPS3A CYS-74; ARG-106; PRO-163; ARG-191; TYR-403 DEL AND TRP-433, CATALYTIC ACTIVITY, FUNCTION, SUBCELLULAR LOCATION. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.054 ng/mL

SGSH ELISA Kit (Human) (OKDD00523)

OKDD00523 96 Wells
EUR 975
Description: Description of target: This gene encodes one of several enzymes involved in the lysosomal degradation of heparan sulfate. Mutations in this gene are associated with Sanfilippo syndrome A, one type of the lysosomal storage disease mucopolysaccaridosis III, which results from impaired degradation of heparan sulfate. Transcripts of varying sizes have been reported but their biological validity has not been determined.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.054 ng/mL

SGSH ELISA Kit (Human) (OKEH07909)

OKEH07909 96 Wells
EUR 896
Description: Description of target: This gene encodes the enzyme sulfamidase; one of several enzymes involved in the lysosomal degradation of heparan sulfate. Mutations in this gene are associated with the lysosomal storage disease mucopolysaccaridosis IIIA, also known as Sanfilippo syndrome A, which results from impaired degradation of heparan sulfate. Transcripts of varying sizes have been reported but their biological validity has not been determined.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 18pg/mL

SGSH Recombinant Protein (Mouse)

RP171530 100 ug Ask for price

SGSH antibody

22030-100ul 100ul
EUR 390

SGSH antibody

22031-100ul 100ul
EUR 390

SGSH antibody

70R-12598 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal SGSH antibody

SGSH antibody

70R-12599 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal SGSH antibody

SGSH antibody

70R-20229 50 ul
EUR 435
Description: Rabbit polyclonal SGSH antibody

SGSH Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SGSH. Recognizes SGSH from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

SGSH Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SGSH. Recognizes SGSH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA14622 50 ug
EUR 363
Description: Mouse polyclonal to SGSH


YF-PA14623 100 ul
EUR 403
Description: Rabbit polyclonal to SGSH


YF-PA14624 100 ug
EUR 403
Description: Rabbit polyclonal to SGSH

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Sgsh ORF Vector (Mouse) (pORF)

ORF057178 1.0 ug DNA
EUR 506

SGSH Protein Vector (Human) (pPB-N-His)

PV037862 500 ng
EUR 329

SGSH Polyclonal Antibody

31452-100ul 100ul
EUR 252

SGSH Polyclonal Antibody

31452-50ul 50ul
EUR 187

Polyclonal SGSH Antibody

APR13287G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SGSH . This antibody is tested and proven to work in the following applications:

SGSH cloning plasmid

CSB-CL021200HU-10ug 10ug
EUR 532
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1509
  • Sequence: atgagctgccccgtgcccgcctgctgcgcgctgctgctagtcctggggctctgccgggcgcgtccccggaacgcactgctgctcctcgcggatgacggaggctttgagagtggcgcgtacaacaacagcgccatcgccaccccgcacctggacgccttggcccgccgcagcctcc
  • Show more
Description: A cloning plasmid for the SGSH gene.

SGSH Rabbit pAb

A8148-100ul 100 ul
EUR 308

SGSH Rabbit pAb

A8148-200ul 200 ul
EUR 459

SGSH Rabbit pAb

A8148-20ul 20 ul
EUR 183

SGSH Rabbit pAb

A8148-50ul 50 ul
EUR 223

anti- SGSH antibody

FNab07813 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:100
  • Immunogen: N-sulfoglucosamine sulfohydrolase
  • Uniprot ID: P51688
  • Gene ID: 6448
  • Research Area: Metabolism
Description: Antibody raised against SGSH

Anti-SGSH antibody

PAab07813 100 ug
EUR 355


PVT19125 2 ug
EUR 231

Anti-SGSH antibody

STJ110447 100 µl
EUR 277
Description: This gene encodes one of several enzymes involved in the lysosomal degradation of heparan sulfate. Mutations in this gene are associated with Sanfilippo syndrome A, one type of the lysosomal storage disease mucopolysaccaridosis III, which results from impaired degradation of heparan sulfate. Transcripts of varying sizes have been reported but their biological validity has not been determined.

Recombinant Human N-Sulphoglucosamine Sulphohydrolase/SGSH (C-6His)

CA15-10ug 10ug
EUR 202
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl,150mM NaCl,1mM GaCl2,10%Glycerol,pH7.5.

Recombinant Human N-Sulphoglucosamine Sulphohydrolase/SGSH (C-6His)

CA15-1mg 1mg
EUR 2283
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl,150mM NaCl,1mM GaCl2,10%Glycerol,pH7.5.

Recombinant Human N-Sulphoglucosamine Sulphohydrolase/SGSH (C-6His)

CA15-500ug 500ug
EUR 1613
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl,150mM NaCl,1mM GaCl2,10%Glycerol,pH7.5.

Recombinant Human N-Sulphoglucosamine Sulphohydrolase/SGSH (C-6His)

CA15-50ug 50ug
EUR 496
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl,150mM NaCl,1mM GaCl2,10%Glycerol,pH7.5.

Sgsh sgRNA CRISPR Lentivector set (Mouse)

K3681901 3 x 1.0 ug
EUR 339

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

SGSH Polyclonal Conjugated Antibody

C31452 100ul
EUR 397

Human SGSH shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SGSH Recombinant Protein (Human)

RP028396 100 ug Ask for price

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266


NAG15-N 1 g
EUR 286

Sgsh sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3681902 1.0 ug DNA
EUR 154

Sgsh sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3681903 1.0 ug DNA
EUR 154

Sgsh sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3681904 1.0 ug DNA
EUR 154

SGSH Protein Vector (Mouse) (pPB-C-His)

PV228710 500 ng
EUR 603

SGSH Protein Vector (Mouse) (pPM-C-HA)

PV228712 500 ng
EUR 603

SGSH Protein Vector (Mouse) (pPM-C-His)

PV228713 500 ng
EUR 603

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

Polyclonal SGSH Antibody (C-Term)

APR13288G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SGSH (C-Term). This antibody is tested and proven to work in the following applications:

SGSH ORF Vector (Human) (pORF)

ORF009466 1.0 ug DNA
EUR 95

pECMV-Sgsh-m-FLAG Plasmid

PVT15005 2 ug
EUR 325

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]

EUR 153
  • Category: Cas9

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Recombinant 2019-nCoV N protein

N-127V 100ug
EUR 1610
  • Concentration 1.0 mg/ml
Description: Recombinant 2019-nCoV N protein was expressed in E. coli and purified by Ni column.; Coronaviruses have positive-sense RNA genome and a nucleocapsid of helical symmetry.Coronavirus N protein is required for coronavirus RNA synthesis, and has RNA chaperone activity that may be involved in template switch.N protein of coronavirus is chosen as a diagnostic tool.

SGSH sgRNA CRISPR Lentivector set (Human)

K2137801 3 x 1.0 ug
EUR 339

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

N-AcetyIneuraminic Acid, Sialic acid; NANA; Neu5Ac

SLA15-N 5 mg
EUR 164

vWF Acty. Kit

ABP-ACT-KIT 12 x 8 microwells
EUR 428

vWF Ant. Kit

ABP-TOT-KIT 12 x 8 microwells
EUR 394

Sgsh sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3681905 3 x 1.0 ug
EUR 376

SGSH sgRNA CRISPR Lentivector (Human) (Target 1)

K2137802 1.0 ug DNA
EUR 154

SGSH sgRNA CRISPR Lentivector (Human) (Target 2)

K2137803 1.0 ug DNA
EUR 154

SGSH sgRNA CRISPR Lentivector (Human) (Target 3)

K2137804 1.0 ug DNA
EUR 154

SGSH Protein Vector (Human) (pPB-C-His)

PV037861 500 ng
EUR 329

SGSH Protein Vector (Human) (pPM-C-HA)

PV037863 500 ng
EUR 329

SGSH Protein Vector (Human) (pPM-C-His)

PV037864 500 ng
EUR 329

Sgsh 3'UTR Luciferase Stable Cell Line

TU118728 1.0 ml Ask for price

Sgsh 3'UTR GFP Stable Cell Line

TU168728 1.0 ml Ask for price

SGSH 3'UTR GFP Stable Cell Line

TU073075 1.0 ml
EUR 1394

SGSH 3'UTR Luciferase Stable Cell Line

TU023075 1.0 ml
EUR 1394

hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)

CAS620A-KIT 1 kit
EUR 2152
  • Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)

Mouse SGSH(N-Sulfoglucosamine Sulfohydrolase) ELISA Equipment