Mouse PCYOX1(Prenylcysteine Oxidase 1) ELISA Package
Mouse Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit |
RD-PCYOX1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
Mouse Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit |
RDR-PCYOX1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Mouse Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit |
RDR-PCYOX1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 774 |
Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit |
DLR-PCYOX1-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Prenylcysteine Oxidase 1 (PCYOX1) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit |
DLR-PCYOX1-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Prenylcysteine Oxidase 1 (PCYOX1) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit |
RD-PCYOX1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit |
RD-PCYOX1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit |
RDR-PCYOX1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit |
RDR-PCYOX1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Mouse Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit |
20-abx154511 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit |
SEH428Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4862.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Prenylcysteine Oxidase 1 (PCYOX1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Prenylcysteine Oxidase 1 (PCYOX1) in Tissue homogenates, cell lysates and other biological fluids. |
Mouse Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit |
SEH428Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 488.08 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Prenylcysteine Oxidase 1 (PCYOX1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Prenylcysteine Oxidase 1 (PCYOX1) in Tissue homogenates, cell lysates and other biological fluids. |
Mouse Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit |
SEH428Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 654.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Prenylcysteine Oxidase 1 (PCYOX1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Prenylcysteine Oxidase 1 (PCYOX1) in Tissue homogenates, cell lysates and other biological fluids. |
Mouse Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit |
SEH428Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2644.8 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Prenylcysteine Oxidase 1 (PCYOX1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Prenylcysteine Oxidase 1 (PCYOX1) in Tissue homogenates, cell lysates and other biological fluids. |
Mouse Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit |
4-SEH428Mu |
Cloud-Clone |
-
EUR 4913.00
-
EUR 2595.00
-
EUR 655.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Prenylcysteine Oxidase 1 elisa. Alternative names of the recognized antigen: PCL1
- Prenylcysteine lyase
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Prenylcysteine Oxidase 1 (PCYOX1) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Mouse Prenylcysteine oxidase, Pcyox1 ELISA KIT |
ELI-12394m |
Lifescience Market |
96 Tests |
EUR 865 |
Prenylcysteine Oxidase 1 (PCYOX1) Antibody |
20-abx114673 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Prenylcysteine Oxidase 1 (PCYOX1) Antibody |
20-abx131433 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1233.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Prenylcysteine Oxidase 1 (PCYOX1) Antibody |
20-abx131434 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Prenylcysteine Oxidase 1 (PCYOX1) Antibody |
20-abx174153 |
Abbexa |
|
|
|
Prenylcysteine Oxidase 1 (PCYOX1) Antibody |
20-abx178078 |
Abbexa |
|
|
|
Prenylcysteine Oxidase 1 (PCYOX1) Antibody |
20-abx217664 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Prenylcysteine Oxidase 1 (PCYOX1) Antibody |
abx340058-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Prenylcysteine Oxidase 1 (PCYOX1) Antibody |
abx236231-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Recombinant Prenylcysteine Oxidase 1 (PCYOX1) |
4-RPH428Hu01 |
Cloud-Clone |
-
EUR 453.02
-
EUR 224.00
-
EUR 1423.84
-
EUR 541.28
-
EUR 982.56
-
EUR 366.00
-
EUR 3409.60
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q9UHG3
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 67.3kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Prenylcysteine Oxidase 1 expressed in: E.coli |
Recombinant Prenylcysteine Oxidase 1 (PCYOX1) |
4-RPH428Mu01 |
Cloud-Clone |
-
EUR 494.24
-
EUR 235.00
-
EUR 1578.40
-
EUR 592.80
-
EUR 1085.60
-
EUR 394.00
-
EUR 3796.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q9CQF9
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 32.8kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Mouse Prenylcysteine Oxidase 1 expressed in: E.coli |
Mouse Prenylcysteine Oxidase 1 (PCYOX1) Protein |
20-abx650731 |
Abbexa |
-
EUR 690.00
-
EUR 286.00
-
EUR 2124.00
-
EUR 815.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Mouse Prenylcysteine Oxidase 1 (PCYOX1) CLIA Kit |
20-abx495449 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Prenylcysteine oxidase 1, PCYOX1 ELISA KIT |
ELI-45170h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit |
20-abx152665 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Prenylcysteine oxidase 1(PCYOX1) ELISA kit |
CSB-EL017652HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Prenylcysteine oxidase 1 (PCYOX1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Prenylcysteine oxidase 1(PCYOX1) ELISA kit |
1-CSB-EL017652HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Prenylcysteine oxidase 1(PCYOX1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit |
SEH428Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prenylcysteine Oxidase 1 (PCYOX1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prenylcysteine Oxidase 1 (PCYOX1) in Tissue homogenates, cell lysates and other biological fluids. |
Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit |
SEH428Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prenylcysteine Oxidase 1 (PCYOX1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prenylcysteine Oxidase 1 (PCYOX1) in Tissue homogenates, cell lysates and other biological fluids. |
Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit |
SEH428Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prenylcysteine Oxidase 1 (PCYOX1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prenylcysteine Oxidase 1 (PCYOX1) in Tissue homogenates, cell lysates and other biological fluids. |
Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit |
SEH428Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prenylcysteine Oxidase 1 (PCYOX1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prenylcysteine Oxidase 1 (PCYOX1) in Tissue homogenates, cell lysates and other biological fluids. |
Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit |
4-SEH428Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Prenylcysteine Oxidase 1 elisa. Alternative names of the recognized antigen: PCL1
- Prenylcysteine lyase
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Prenylcysteine Oxidase 1 (PCYOX1) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
ELISA kit for Mouse PCYOX1 (Prenylcysteine Oxidase 1) |
ELK6955 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Prenylcysteine Oxidase 1 (PCYOX1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to
- Show more
|
Description: A sandwich ELISA kit for detection of Prenylcysteine Oxidase 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Mouse Prenylcysteine oxidase 1 (PCYOX1) |
KTE70784-48T |
Abbkine |
48T |
EUR 332 |
- Prenylcysteine is released during the degradation of prenylated proteins. PCYOX1 catalyzes the degradation of prenylcysteine to yield free cysteines and a hydrophobic isoprenoid product .
The deduced 505-amino acid protein contains a predicted signal
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Prenylcysteine oxidase 1 (PCYOX1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Prenylcysteine oxidase 1 (PCYOX1) |
KTE70784-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Prenylcysteine is released during the degradation of prenylated proteins. PCYOX1 catalyzes the degradation of prenylcysteine to yield free cysteines and a hydrophobic isoprenoid product .
The deduced 505-amino acid protein contains a predicted signal
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Prenylcysteine oxidase 1 (PCYOX1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Prenylcysteine oxidase 1 (PCYOX1) |
KTE70784-96T |
Abbkine |
96T |
EUR 539 |
- Prenylcysteine is released during the degradation of prenylated proteins. PCYOX1 catalyzes the degradation of prenylcysteine to yield free cysteines and a hydrophobic isoprenoid product .
The deduced 505-amino acid protein contains a predicted signal
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Prenylcysteine oxidase 1 (PCYOX1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Mouse) |
4-PAH428Mu01 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2576.00
-
EUR 640.00
-
EUR 316.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PCYOX1 (Ala249~Leu505)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Prenylcysteine Oxidase 1 (PCYOX1) |
Human Prenylcysteine Oxidase 1 (PCYOX1) Protein |
20-abx650730 |
Abbexa |
-
EUR 634.00
-
EUR 272.00
-
EUR 1929.00
-
EUR 759.00
-
EUR 467.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Prenylcysteine Oxidase 1 (PCYOX1) CLIA Kit |
20-abx495448 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Human PCYOX1 (Prenylcysteine Oxidase 1) |
ELK4169 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Prenylcysteine Oxidase 1 (PCYOX1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to
- Show more
|
Description: A sandwich ELISA kit for detection of Prenylcysteine Oxidase 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human Prenylcysteine oxidase 1 (PCYOX1) |
KTE61281-48T |
Abbkine |
48T |
EUR 332 |
- Prenylcysteine is released during the degradation of prenylated proteins. PCYOX1 catalyzes the degradation of prenylcysteine to yield free cysteines and a hydrophobic isoprenoid product .
The deduced 505-amino acid protein contains a predicted signal
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Prenylcysteine oxidase 1 (PCYOX1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Prenylcysteine oxidase 1 (PCYOX1) |
KTE61281-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Prenylcysteine is released during the degradation of prenylated proteins. PCYOX1 catalyzes the degradation of prenylcysteine to yield free cysteines and a hydrophobic isoprenoid product .
The deduced 505-amino acid protein contains a predicted signal
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Prenylcysteine oxidase 1 (PCYOX1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Prenylcysteine oxidase 1 (PCYOX1) |
KTE61281-96T |
Abbkine |
96T |
EUR 539 |
- Prenylcysteine is released during the degradation of prenylated proteins. PCYOX1 catalyzes the degradation of prenylcysteine to yield free cysteines and a hydrophobic isoprenoid product .
The deduced 505-amino acid protein contains a predicted signal
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Prenylcysteine oxidase 1 (PCYOX1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Human, Mouse) |
4-PAH428Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PCYOX1 (Tyr174~Leu505)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Prenylcysteine Oxidase 1 (PCYOX1) |
Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Mouse), APC |
4-PAH428Mu01-APC |
Cloud-Clone |
-
EUR 351.00
-
EUR 3365.00
-
EUR 935.00
-
EUR 449.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PCYOX1 (Ala249~Leu505)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with APC. |
Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Mouse), Biotinylated |
4-PAH428Mu01-Biotin |
Cloud-Clone |
-
EUR 316.00
-
EUR 2526.00
-
EUR 744.00
-
EUR 387.00
-
EUR 221.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PCYOX1 (Ala249~Leu505)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with Biotin. |
Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Mouse), Cy3 |
4-PAH428Mu01-Cy3 |
Cloud-Clone |
-
EUR 427.00
-
EUR 4445.00
-
EUR 1205.00
-
EUR 557.00
-
EUR 254.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PCYOX1 (Ala249~Leu505)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with Cy3. |
Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Mouse), FITC |
4-PAH428Mu01-FITC |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PCYOX1 (Ala249~Leu505)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with FITC. |
Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Mouse), HRP |
4-PAH428Mu01-HRP |
Cloud-Clone |
-
EUR 321.00
-
EUR 2933.00
-
EUR 827.00
-
EUR 405.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PCYOX1 (Ala249~Leu505)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with HRP. |
Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Mouse), PE |
4-PAH428Mu01-PE |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PCYOX1 (Ala249~Leu505)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with PE. |
Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Human, Mouse), APC |
4-PAH428Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PCYOX1 (Tyr174~Leu505)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with APC. |
Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Human, Mouse), Biotinylated |
4-PAH428Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PCYOX1 (Tyr174~Leu505)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with Biotin. |
Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Human, Mouse), Cy3 |
4-PAH428Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PCYOX1 (Tyr174~Leu505)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with Cy3. |
Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Human, Mouse), FITC |
4-PAH428Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PCYOX1 (Tyr174~Leu505)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with FITC. |
Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Human, Mouse), HRP |
4-PAH428Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PCYOX1 (Tyr174~Leu505)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with HRP. |
Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Human, Mouse), PE |
4-PAH428Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PCYOX1 (Tyr174~Leu505)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with PE. |
Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Mouse), APC-Cy7 |
4-PAH428Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 583.00
-
EUR 6610.00
-
EUR 1750.00
-
EUR 778.00
-
EUR 324.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PCYOX1 (Ala249~Leu505)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with APC-Cy7. |
Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Human, Mouse), APC-Cy7 |
4-PAH428Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PCYOX1 (Tyr174~Leu505)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with APC-Cy7. |
Mouse Prenylcysteine oxidase- like, Pcyox1l ELISA KIT |
ELI-45171m |
Lifescience Market |
96 Tests |
EUR 865 |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Bovine Prenylcysteine oxidase- like, PCYOX1L ELISA KIT |
ELI-43159b |
Lifescience Market |
96 Tests |
EUR 928 |
Human Prenylcysteine oxidase- like, PCYOX1L ELISA KIT |
ELI-43160h |
Lifescience Market |
96 Tests |
EUR 824 |
Prenylcysteine Oxidase-Like (PCYXL) Antibody |
abx032568-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Prenylcysteine Oxidase-Like (PCYXL) Antibody |
abx032568-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Mouse PCYOX1 shRNA Plasmid |
20-abx975836 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
PCYOX1 Recombinant Protein (Mouse) |
RP160775 |
ABM |
100 ug |
Ask for price |
PCYOX1 siRNA |
20-abx903878 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PCYOX1 siRNA |
20-abx928016 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PCYOX1 siRNA |
20-abx928017 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PCYOX1 Antibody |
45274-100ul |
SAB |
100ul |
EUR 252 |
PCYOX1 Antibody |
45274-50ul |
SAB |
50ul |
EUR 187 |
PCYOX1 antibody |
70R-19165 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal PCYOX1 antibody |
PCYOX1 Antibody |
DF8332 |
Affbiotech |
200ul |
EUR 304 |
Description: PCYOX1 Antibody detects endogenous levels of total PCYOX1. |
PCYOX1 Antibody |
1-CSB-PA017652GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against PCYOX1. Recognizes PCYOX1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
anti-PCYOX1 |
YF-PA26185 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to PCYOX1 |
mRNAExpress mRNA Synthesis kit (5 reactions) |
MR-KIT-1 |
SBI |
5 reactions |
EUR 1152 |
- Category: Stem Cell Products
|
Pcyox1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3674502 |
ABM |
1.0 ug DNA |
EUR 154 |
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN320A-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN340iPS-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
Mouse Aldehyde Oxidase 1 (AOX1) ELISA Kit |
abx520547-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Mouse NADPH oxidase 1 (NOX1) ELISA Kit |
abx520821-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Mouse Sulfhydryl Oxidase 1 (QSOX1) ELISA Kit |
abx576447-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 1-2 months.
|
Mouse Dual oxidase 1(DUOX1) ELISA kit |
E03D0296-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Dual oxidase 1(DUOX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Dual oxidase 1(DUOX1) ELISA kit |
E03D0296-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Dual oxidase 1(DUOX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Dual oxidase 1(DUOX1) ELISA kit |
E03D0296-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Dual oxidase 1(DUOX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Quiescin Sulfhydryl Oxidase 1 ELISA kit |
E03Q0001-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Quiescin Sulfhydryl Oxidase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Quiescin Sulfhydryl Oxidase 1 ELISA kit |
E03Q0001-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Quiescin Sulfhydryl Oxidase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Quiescin Sulfhydryl Oxidase 1 ELISA kit |
E03Q0001-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Quiescin Sulfhydryl Oxidase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Sulfhydryl oxidase 1(QSOX1) ELISA kit |
E03S0347-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Sulfhydryl oxidase 1(QSOX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Sulfhydryl oxidase 1(QSOX1) ELISA kit |
E03S0347-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Sulfhydryl oxidase 1(QSOX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Sulfhydryl oxidase 1(QSOX1) ELISA kit |
E03S0347-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Sulfhydryl oxidase 1(QSOX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
ELISA kit for Mouse NADPH oxidase 1 |
EK4834 |
SAB |
96 tests |
EUR 603 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse NADPH oxidase 1 in samples from serum, plasma, tissue homogenates and other biological fluids. |
Mouse Nox1/ NADPH oxidase 1 ELISA Kit |
E1043Mo |
Sunlong |
1 Kit |
EUR 632 |
Mouse Hydroxyacid oxidase 1, Hao1 ELISA KIT |
ELI-08008m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Sulfhydryl oxidase 1, Qsox1 ELISA KIT |
ELI-43054m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Nox1(NADPH oxidase 1) ELISA Kit |
EM0800 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 15.6-1000 pg/ml
- Uniprot ID: Q8CIZ9
- Alias: Nox1/NOH-1/Mitogenic oxidase 1(MOX-1)/NADH/NADPH mitogenic oxidase subunit P65-MOX/Nicotinamide Adenine Dinucleotide Phosphate Oxidase 1
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 9.375pg/ml |
Mouse NADPH Oxidase 1 (NOX1) ELISA Kit |
abx255148-96tests |
Abbexa |
96 tests |
EUR 746 |
- Shipped within 5-12 working days.
|
Mouse Hydroxyacid oxidase 1(HAO1) ELISA kit |
CSB-EL010127MO-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Hydroxyacid oxidase 1 (HAO1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Mouse Hydroxyacid oxidase 1(HAO1) ELISA kit |
1-CSB-EL010127MO |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Hydroxyacid oxidase 1(HAO1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Mouse Aox1/ Aldehyde oxidase 1 ELISA Kit |
E0105Mo |
Sunlong |
1 Kit |
EUR 571 |
Qsox1 ELISA Kit| Mouse Sulfhydryl oxidase 1 ELISA Kit |
EF016016 |
Lifescience Market |
96 Tests |
EUR 689 |
Nox1 ELISA Kit| Mouse NADPH oxidase 1 ELISA Kit |
EF013410 |
Lifescience Market |
96 Tests |
EUR 689 |
Pcyox1 ORF Vector (Mouse) (pORF) |
ORF053593 |
ABM |
1.0 ug DNA |
EUR 506 |
ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody |
EXOAB-KIT-1 |
SBI |
25 ul each |
EUR 627 |
|
Mouse Xanthione oxidase ELISA kit |
E03X0001-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Xanthione oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Xanthione oxidase ELISA kit |
E03X0001-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Xanthione oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Xanthione oxidase ELISA kit |
E03X0001-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Xanthione oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Lysyl oxidase ELISA kit |
E03L0305-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Lysyl oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Lysyl oxidase ELISA kit |
E03L0305-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Lysyl oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Lysyl oxidase ELISA kit |
E03L0305-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Lysyl oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Monoamine Oxidase ELISA kit |
E03M0224-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Monoamine Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Monoamine Oxidase ELISA kit |
E03M0224-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Monoamine Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Monoamine Oxidase ELISA kit |
E03M0224-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Monoamine Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Diamine Oxidase ELISA kit |
E03D0032-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Diamine Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Diamine Oxidase ELISA kit |
E03D0032-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Diamine Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Diamine Oxidase ELISA kit |
E03D0032-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Diamine Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Glucose Oxidase ELISA kit |
E03G0341-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Glucose Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Glucose Oxidase ELISA kit |
E03G0341-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Glucose Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Glucose Oxidase ELISA kit |
E03G0341-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Glucose Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
PCYOX1 Conjugated Antibody |
C45274 |
SAB |
100ul |
EUR 397 |
PCYOX1 cloning plasmid |
CSB-CL017652HU-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1518
- Sequence: atggggcgcgtcgtcgcggagcttgtctcctcgctgctggggttgtggctgttgctgtgcagctgcggatgccccgagggcgccgagctgcgtgctccgccagataaaatcgcgattattggagccggaattggtggcacttcagcagcctattacctgcggcagaaatttggga
- Show more
|
Description: A cloning plasmid for the PCYOX1 gene. |
anti- PCYOX1 antibody |
FNab06231 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: prenylcysteine oxidase 1
- Uniprot ID: Q9UHG3
- Gene ID: 51449
- Research Area: Metabolism
|
Description: Antibody raised against PCYOX1 |
PCYOX1 Blocking Peptide |
DF8332-BP |
Affbiotech |
1mg |
EUR 195 |
PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN300A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents) |
CAS510A-KIT |
SBI |
1 Kit |
EUR 805 |
|
Mouse Lysyl Oxidase Like 1 (LOXL1) ELISA Kit |
abx575650-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Mouse NADPH oxidase organizer 1, Noxo1 ELISA KIT |
ELI-21241m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse NADPH oxidase activator 1, Noxa1 ELISA KIT |
ELI-35317m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse NADPH oxidase activator 1 (NOXA1) ELISA Kit |
abx389985-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse NADPH oxidase organizer 1 (NOXO1) ELISA Kit |
abx389986-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
ELISA kit for Mouse Sulfhydryl oxidase 1 (QSOX1) |
KTE70579-48T |
Abbkine |
48T |
EUR 332 |
- Sulfhydryl oxidase 1 is a protein that contains domains of thioredoxin and ERV1, members of two long-standing gene families. The gene expression is induced as fibroblasts begin to exit the proliferative cycle and enter quiescence, suggesting that thi
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Sulfhydryl oxidase 1 (QSOX1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Sulfhydryl oxidase 1 (QSOX1) |
KTE70579-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Sulfhydryl oxidase 1 is a protein that contains domains of thioredoxin and ERV1, members of two long-standing gene families. The gene expression is induced as fibroblasts begin to exit the proliferative cycle and enter quiescence, suggesting that thi
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Sulfhydryl oxidase 1 (QSOX1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Sulfhydryl oxidase 1 (QSOX1) |
KTE70579-96T |
Abbkine |
96T |
EUR 539 |
- Sulfhydryl oxidase 1 is a protein that contains domains of thioredoxin and ERV1, members of two long-standing gene families. The gene expression is induced as fibroblasts begin to exit the proliferative cycle and enter quiescence, suggesting that thi
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Sulfhydryl oxidase 1 (QSOX1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Noxa1 ELISA Kit| Mouse NADPH oxidase activator 1 ELISA Kit |
EF015624 |
Lifescience Market |
96 Tests |
EUR 689 |
Noxo1 ELISA Kit| Mouse NADPH oxidase organizer 1 ELISA Kit |
EF015625 |
Lifescience Market |
96 Tests |
EUR 689 |
PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN400A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN410A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN412A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
Pcyox1 sgRNA CRISPR Lentivector set (Mouse) |
K3674501 |
ABM |
3 x 1.0 ug |
EUR 339 |
AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS |
AP-STR-KIT-1 |
CORNING |
1/pk |
EUR 355 |
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
Mouse Spermine oxidase (SMOX) ELISA Kit |
abx572544-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Mouse Xanthine dehydrogenase/oxidase ELISA kit |
E03X0012-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Xanthine dehydrogenase/oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Xanthine dehydrogenase/oxidase ELISA kit |
E03X0012-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Xanthine dehydrogenase/oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Xanthine dehydrogenase/oxidase ELISA kit |
E03X0012-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Xanthine dehydrogenase/oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Monoamine oxidase A ELISA kit |
E03M0225-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Monoamine oxidase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Monoamine oxidase A ELISA kit |
E03M0225-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Monoamine oxidase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Monoamine oxidase A ELISA kit |
E03M0225-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Monoamine oxidase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Cytochrome c oxidase ELISA kit |
E03C0015-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Cytochrome c oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Cytochrome c oxidase ELISA kit |
E03C0015-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Cytochrome c oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Cytochrome c oxidase ELISA kit |
E03C0015-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Cytochrome c oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Cytochrome Oxidase 4 ELISA kit |
E03C0103-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Cytochrome Oxidase 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Cytochrome Oxidase 4 ELISA kit |
E03C0103-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Cytochrome Oxidase 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Cytochrome Oxidase 4 ELISA kit |
E03C0103-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Cytochrome Oxidase 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Acetyl CoA oxidase ELISA kit |
E03A0641-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Acetyl CoA oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Acetyl CoA oxidase ELISA kit |
E03A0641-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Acetyl CoA oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Acetyl CoA oxidase ELISA kit |
E03A0641-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Acetyl CoA oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Aldehyde oxidase(AOX1) ELISA kit |
E03A1553-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Aldehyde oxidase(AOX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Aldehyde oxidase(AOX1) ELISA kit |
E03A1553-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Aldehyde oxidase(AOX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Aldehyde oxidase(AOX1) ELISA kit |
E03A1553-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Aldehyde oxidase(AOX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
ELISA kit for Mouse Spermine oxidase |
EK4455 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Spermine oxidase in samples from serum, plasma, tissue homogenates and other biological fluids. |
Mouse Smox/ Spermine oxidase ELISA Kit |
E1382Mo |
Sunlong |
1 Kit |
EUR 571 |
Mouse diamine oxidase(DAO)ELISA Kit |
GA-E0588MS-48T |
GenAsia Biotech |
48T |
EUR 336 |
Mouse diamine oxidase(DAO)ELISA Kit |
GA-E0588MS-96T |
GenAsia Biotech |
96T |
EUR 534 |
Mouse Protoporphyrinogen oxidase, Ppox ELISA KIT |
ELI-36548m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Smox(Spermine oxidase) ELISA Kit |
EM0749 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.312-20 ng/ml
- Uniprot ID: Q99K82
- Alias: Smox/SMOX(Spermine oxidase)Polyamine oxidase 1/PAO-1/PAOh1
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.188 ng/ml |
Mouse DAO(Diamine Oxidase) ELISA Kit |
EM0980 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 3.906-250 ng/ml
- Uniprot ID: P18894
- Alias: DAO/AOC1/DAO/Diamine Oxidase/Histaminase/KAO/ABP/amiloride binding protein 1(amine oxidase(copper-containing))/Amiloride-binding protein/amiloride-sensitive amine oxidase/amiloride-sensitive
- Show more
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 2.344 ng/ml |
Mouse LOX(Lysyl Oxidase) ELISA Kit |
EM1614 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.313-20 ng/ml
- Alias: Lysyl Oxidase
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.188 ng/ml |
Mouse XOD(Xantine oxidase) ELISA Kit |
EM1865 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 78-5000 pg/ml
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 46.9pg/ml |
Mouse Lysyl Oxidase (LOX) ELISA Kit |
20-abx154350 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Polyamine Oxidase (PAOX) ELISA Kit |
20-abx154565 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Spermine Oxidase (SMOX) ELISA Kit |
20-abx154701 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Sulfite Oxidase (SUOX) ELISA Kit |
20-abx154719 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Monoamine Oxidase (MAO) ELISA Kit |
abx350797-96tests |
Abbexa |
96 tests |
EUR 786 |
- Shipped within 5-12 working days.
|
Mouse Spermine oxidase (SMOX) ELISA Kit |
abx255097-96tests |
Abbexa |
96 tests |
EUR 746 |
- Shipped within 5-12 working days.
|
Mouse Lysyl Oxidase (LOX) ELISA Kit |
abx257820-96tests |
Abbexa |
96 tests |
EUR 754 |
- Shipped within 5-12 working days.
|
Mouse PCYOX1(Prenylcysteine Oxidase 1) ELISA Package