Mouse PCYOX1(Prenylcysteine Oxidase 1) ELISA Kit

Mouse PCYOX1(Prenylcysteine Oxidase 1) ELISA Package

Mouse Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit

RDR-PCYOX1-Mu-96Tests 96 Tests
EUR 774

Mouse Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit

RD-PCYOX1-Mu-48Tests 48 Tests
EUR 533

Mouse Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit

RD-PCYOX1-Mu-96Tests 96 Tests
EUR 740

Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit

DLR-PCYOX1-Hu-48T 48T
EUR 517
  • Should the Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Prenylcysteine Oxidase 1 (PCYOX1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit

DLR-PCYOX1-Hu-96T 96T
EUR 673
  • Should the Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Prenylcysteine Oxidase 1 (PCYOX1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit

RDR-PCYOX1-Hu-48Tests 48 Tests
EUR 544

Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit

RDR-PCYOX1-Hu-96Tests 96 Tests
EUR 756

Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit

RD-PCYOX1-Hu-48Tests 48 Tests
EUR 521

Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit

RD-PCYOX1-Hu-96Tests 96 Tests
EUR 723

Mouse Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit

20-abx154511
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit

SEH428Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Prenylcysteine Oxidase 1 (PCYOX1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Prenylcysteine Oxidase 1 (PCYOX1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit

SEH428Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Prenylcysteine Oxidase 1 (PCYOX1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Prenylcysteine Oxidase 1 (PCYOX1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit

SEH428Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Prenylcysteine Oxidase 1 (PCYOX1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Prenylcysteine Oxidase 1 (PCYOX1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit

SEH428Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Prenylcysteine Oxidase 1 (PCYOX1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Prenylcysteine Oxidase 1 (PCYOX1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit

4-SEH428Mu
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Prenylcysteine Oxidase 1 elisa. Alternative names of the recognized antigen: PCL1
  • Prenylcysteine lyase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Prenylcysteine Oxidase 1 (PCYOX1) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Prenylcysteine oxidase, Pcyox1 ELISA KIT

ELI-12394m 96 Tests
EUR 865

Prenylcysteine Oxidase 1 (PCYOX1) Antibody

20-abx217664
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Prenylcysteine Oxidase 1 (PCYOX1) Antibody

20-abx178078
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Prenylcysteine Oxidase 1 (PCYOX1) Antibody

20-abx114673
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Prenylcysteine Oxidase 1 (PCYOX1) Antibody

20-abx131433
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Prenylcysteine Oxidase 1 (PCYOX1) Antibody

20-abx131434
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Prenylcysteine Oxidase 1 (PCYOX1) Antibody

20-abx174153
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Prenylcysteine Oxidase 1 (PCYOX1) Antibody

abx340058-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Prenylcysteine Oxidase 1 (PCYOX1) Antibody

abx236231-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Recombinant Prenylcysteine Oxidase 1 (PCYOX1)

4-RPH428Hu01
  • EUR 453.02
  • EUR 224.00
  • EUR 1423.84
  • EUR 541.28
  • EUR 982.56
  • EUR 366.00
  • EUR 3409.60
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9UHG3
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 67.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Prenylcysteine Oxidase 1 expressed in: E.coli

Recombinant Prenylcysteine Oxidase 1 (PCYOX1)

4-RPH428Mu01
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9CQF9
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 32.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Prenylcysteine Oxidase 1 expressed in: E.coli

Mouse Prenylcysteine Oxidase 1 (PCYOX1) Protein

20-abx650731
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Prenylcysteine Oxidase 1 (PCYOX1) CLIA Kit

20-abx495449
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Prenylcysteine oxidase 1(PCYOX1) ELISA kit

CSB-EL017652HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Prenylcysteine oxidase 1 (PCYOX1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Prenylcysteine oxidase 1(PCYOX1) ELISA kit

1-CSB-EL017652HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Prenylcysteine oxidase 1(PCYOX1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit

20-abx152665
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Prenylcysteine oxidase 1, PCYOX1 ELISA KIT

ELI-45170h 96 Tests
EUR 824

Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit

SEH428Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prenylcysteine Oxidase 1 (PCYOX1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prenylcysteine Oxidase 1 (PCYOX1) in Tissue homogenates, cell lysates and other biological fluids.

Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit

SEH428Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prenylcysteine Oxidase 1 (PCYOX1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prenylcysteine Oxidase 1 (PCYOX1) in Tissue homogenates, cell lysates and other biological fluids.

Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit

SEH428Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prenylcysteine Oxidase 1 (PCYOX1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prenylcysteine Oxidase 1 (PCYOX1) in Tissue homogenates, cell lysates and other biological fluids.

Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit

SEH428Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prenylcysteine Oxidase 1 (PCYOX1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prenylcysteine Oxidase 1 (PCYOX1) in Tissue homogenates, cell lysates and other biological fluids.

Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit

4-SEH428Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Prenylcysteine Oxidase 1 elisa. Alternative names of the recognized antigen: PCL1
  • Prenylcysteine lyase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Prenylcysteine Oxidase 1 (PCYOX1) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Mouse PCYOX1 (Prenylcysteine Oxidase 1)

ELK6955 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Prenylcysteine Oxidase 1 (PCYOX1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to
  • Show more
Description: A sandwich ELISA kit for detection of Prenylcysteine Oxidase 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse Prenylcysteine oxidase 1 (PCYOX1)

KTE70784-48T 48T
EUR 332
  • Prenylcysteine is released during the degradation of prenylated proteins. PCYOX1 catalyzes the degradation of prenylcysteine to yield free cysteines and a hydrophobic isoprenoid product . The deduced 505-amino acid protein contains a predicted signal
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Prenylcysteine oxidase 1 (PCYOX1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Prenylcysteine oxidase 1 (PCYOX1)

KTE70784-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Prenylcysteine is released during the degradation of prenylated proteins. PCYOX1 catalyzes the degradation of prenylcysteine to yield free cysteines and a hydrophobic isoprenoid product . The deduced 505-amino acid protein contains a predicted signal
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Prenylcysteine oxidase 1 (PCYOX1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Prenylcysteine oxidase 1 (PCYOX1)

KTE70784-96T 96T
EUR 539
  • Prenylcysteine is released during the degradation of prenylated proteins. PCYOX1 catalyzes the degradation of prenylcysteine to yield free cysteines and a hydrophobic isoprenoid product . The deduced 505-amino acid protein contains a predicted signal
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Prenylcysteine oxidase 1 (PCYOX1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Mouse)

4-PAH428Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCYOX1 (Ala249~Leu505)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prenylcysteine Oxidase 1 (PCYOX1)

Human Prenylcysteine Oxidase 1 (PCYOX1) Protein

20-abx650730
  • EUR 634.00
  • EUR 272.00
  • EUR 1929.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Prenylcysteine Oxidase 1 (PCYOX1) CLIA Kit

20-abx495448
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human PCYOX1 (Prenylcysteine Oxidase 1)

ELK4169 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Prenylcysteine Oxidase 1 (PCYOX1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to
  • Show more
Description: A sandwich ELISA kit for detection of Prenylcysteine Oxidase 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Prenylcysteine oxidase 1 (PCYOX1)

KTE61281-48T 48T
EUR 332
  • Prenylcysteine is released during the degradation of prenylated proteins. PCYOX1 catalyzes the degradation of prenylcysteine to yield free cysteines and a hydrophobic isoprenoid product . The deduced 505-amino acid protein contains a predicted signal
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Prenylcysteine oxidase 1 (PCYOX1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Prenylcysteine oxidase 1 (PCYOX1)

KTE61281-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Prenylcysteine is released during the degradation of prenylated proteins. PCYOX1 catalyzes the degradation of prenylcysteine to yield free cysteines and a hydrophobic isoprenoid product . The deduced 505-amino acid protein contains a predicted signal
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Prenylcysteine oxidase 1 (PCYOX1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Prenylcysteine oxidase 1 (PCYOX1)

KTE61281-96T 96T
EUR 539
  • Prenylcysteine is released during the degradation of prenylated proteins. PCYOX1 catalyzes the degradation of prenylcysteine to yield free cysteines and a hydrophobic isoprenoid product . The deduced 505-amino acid protein contains a predicted signal
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Prenylcysteine oxidase 1 (PCYOX1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Human, Mouse)

4-PAH428Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCYOX1 (Tyr174~Leu505)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Prenylcysteine Oxidase 1 (PCYOX1)

Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Mouse), APC

4-PAH428Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCYOX1 (Ala249~Leu505)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with APC.

Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Mouse), Biotinylated

4-PAH428Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCYOX1 (Ala249~Leu505)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with Biotin.

Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Mouse), Cy3

4-PAH428Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCYOX1 (Ala249~Leu505)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with Cy3.

Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Mouse), FITC

4-PAH428Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCYOX1 (Ala249~Leu505)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with FITC.

Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Mouse), HRP

4-PAH428Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCYOX1 (Ala249~Leu505)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with HRP.

Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Mouse), PE

4-PAH428Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCYOX1 (Ala249~Leu505)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with PE.

Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Human, Mouse), APC

4-PAH428Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCYOX1 (Tyr174~Leu505)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with APC.

Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Human, Mouse), Biotinylated

4-PAH428Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCYOX1 (Tyr174~Leu505)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with Biotin.

Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Human, Mouse), Cy3

4-PAH428Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCYOX1 (Tyr174~Leu505)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with Cy3.

Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Human, Mouse), FITC

4-PAH428Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCYOX1 (Tyr174~Leu505)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with FITC.

Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Human, Mouse), HRP

4-PAH428Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCYOX1 (Tyr174~Leu505)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with HRP.

Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Human, Mouse), PE

4-PAH428Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCYOX1 (Tyr174~Leu505)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with PE.

Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Mouse), APC-Cy7

4-PAH428Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCYOX1 (Ala249~Leu505)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with APC-Cy7.

Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Human, Mouse), APC-Cy7

4-PAH428Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCYOX1 (Tyr174~Leu505)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with APC-Cy7.

Mouse Prenylcysteine oxidase- like, Pcyox1l ELISA KIT

ELI-45171m 96 Tests
EUR 865

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Bovine Prenylcysteine oxidase- like, PCYOX1L ELISA KIT

ELI-43159b 96 Tests
EUR 928

Human Prenylcysteine oxidase- like, PCYOX1L ELISA KIT

ELI-43160h 96 Tests
EUR 824

Prenylcysteine Oxidase-Like (PCYXL) Antibody

abx032568-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Prenylcysteine Oxidase-Like (PCYXL) Antibody

abx032568-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Pcyox1/ Rat Pcyox1 ELISA Kit

ELI-14590r 96 Tests
EUR 886

PCYOX1 ELISA Kit (Mouse) (OKCD09052)

OKCD09052 96 Wells
EUR 1001
Description: Description of target: Involved in the degradation of prenylated proteins. cleaves the thioether bond of prenyl-l-cysteines, such as farnesylcysteine and geranylgeranylcysteine (by similarity).;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.072ng/mL

PCYOX1 ELISA Kit (Mouse) (OKDD00815)

OKDD00815 96 Wells
EUR 988
Description: Description of target: Involved in the degradation of prenylated proteins. cleaves the thioether bond of prenyl-l-cysteines, such as farnesylcysteine and geranylgeranylcysteine (by similarity).;Species reactivity: Mouse;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.072ng/mL

PCYOX1 ELISA KIT|Human

EF001621 96 Tests
EUR 689

PCYOX1 ELISA Kit (Human) (OKCD01032)

OKCD01032 96 Wells
EUR 831
Description: Description of target: Involved in the degradation of prenylated proteins. Cleaves the thioether bond of prenyl-L-cysteines, such as farnesylcysteine and geranylgeranylcysteine. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.118 ng/mL

Mouse PCYOX1 shRNA Plasmid

20-abx975836
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PCYOX1 Recombinant Protein (Mouse)

RP160775 100 ug Ask for price

PCYOX1 antibody

70R-19165 50 ul
EUR 435
Description: Rabbit polyclonal PCYOX1 antibody

PCYOX1 Antibody

45274-100ul 100ul
EUR 252

PCYOX1 Antibody

45274-50ul 50ul
EUR 187

PCYOX1 Antibody

DF8332 200ul
EUR 304
Description: PCYOX1 Antibody detects endogenous levels of total PCYOX1.

PCYOX1 Antibody

1-CSB-PA017652GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PCYOX1. Recognizes PCYOX1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

PCYOX1 siRNA

20-abx903878
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PCYOX1 siRNA

20-abx928016
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PCYOX1 siRNA

20-abx928017
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PCYOX1 Antibody

ABD8332 100 ug
EUR 438

anti-PCYOX1

YF-PA26185 50 ul
EUR 334
Description: Mouse polyclonal to PCYOX1

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

Pcyox1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3674502 1.0 ug DNA
EUR 154

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Mouse Aox1/ Aldehyde oxidase 1 ELISA Kit

E0105Mo 1 Kit
EUR 571

Mouse Dual oxidase 1(DUOX1) ELISA kit

E03D0296-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Dual oxidase 1(DUOX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Dual oxidase 1(DUOX1) ELISA kit

E03D0296-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Dual oxidase 1(DUOX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Dual oxidase 1(DUOX1) ELISA kit

E03D0296-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Dual oxidase 1(DUOX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Quiescin Sulfhydryl Oxidase 1 ELISA kit

E03Q0001-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Quiescin Sulfhydryl Oxidase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Quiescin Sulfhydryl Oxidase 1 ELISA kit

E03Q0001-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Quiescin Sulfhydryl Oxidase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Quiescin Sulfhydryl Oxidase 1 ELISA kit

E03Q0001-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Quiescin Sulfhydryl Oxidase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Sulfhydryl oxidase 1(QSOX1) ELISA kit

E03S0347-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Sulfhydryl oxidase 1(QSOX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Sulfhydryl oxidase 1(QSOX1) ELISA kit

E03S0347-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Sulfhydryl oxidase 1(QSOX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Sulfhydryl oxidase 1(QSOX1) ELISA kit

E03S0347-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Sulfhydryl oxidase 1(QSOX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse NADPH Oxidase 1 (NOX1) ELISA Kit

abx255148-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.

ELISA kit for Mouse NADPH oxidase 1

EK4834 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse NADPH oxidase 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Mouse Nox1/ NADPH oxidase 1 ELISA Kit

E1043Mo 1 Kit
EUR 632

Mouse NADPH oxidase 1, Nox1 ELISA KIT

ELI-07626m 96 Tests
EUR 865

Mouse Hydroxyacid oxidase 1, Hao1 ELISA KIT

ELI-08008m 96 Tests
EUR 865

Mouse Sulfhydryl oxidase 1, Qsox1 ELISA KIT

ELI-43054m 96 Tests
EUR 865

Mouse Hydroxyacid oxidase 1(HAO1) ELISA kit

CSB-EL010127MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Hydroxyacid oxidase 1 (HAO1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Hydroxyacid oxidase 1(HAO1) ELISA kit

1-CSB-EL010127MO
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Hydroxyacid oxidase 1(HAO1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Aldehyde Oxidase 1 (AOX1) ELISA Kit

abx520547-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse NADPH oxidase 1 (NOX1) ELISA Kit

abx520821-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Sulfhydryl Oxidase 1 (QSOX1) ELISA Kit

abx576447-96tests 96 tests
EUR 668
  • Shipped within 1-2 months.

Mouse Nox1(NADPH oxidase 1) ELISA Kit

EM0800 96T
EUR 567.6
  • Detection range: 15.6-1000 pg/ml
  • Uniprot ID: Q8CIZ9
  • Alias: Nox1/NOH-1/Mitogenic oxidase 1(MOX-1)/NADH/NADPH mitogenic oxidase subunit P65-MOX/Nicotinamide Adenine Dinucleotide Phosphate Oxidase 1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 9.375pg/ml

Qsox1 ELISA Kit| Mouse Sulfhydryl oxidase 1 ELISA Kit

EF016016 96 Tests
EUR 689

Nox1 ELISA Kit| Mouse NADPH oxidase 1 ELISA Kit

EF013410 96 Tests
EUR 689

Pcyox1 ORF Vector (Mouse) (pORF)

ORF053593 1.0 ug DNA
EUR 506

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

Mouse Glucose Oxidase ELISA kit

E03G0341-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Glucose Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Glucose Oxidase ELISA kit

E03G0341-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Glucose Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Glucose Oxidase ELISA kit

E03G0341-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Glucose Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Xanthione oxidase ELISA kit

E03X0001-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Xanthione oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Xanthione oxidase ELISA kit

E03X0001-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Xanthione oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Xanthione oxidase ELISA kit

E03X0001-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Xanthione oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Lysyl oxidase ELISA kit

E03L0305-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Lysyl oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Lysyl oxidase ELISA kit

E03L0305-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Lysyl oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Lysyl oxidase ELISA kit

E03L0305-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Lysyl oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Monoamine Oxidase ELISA kit

E03M0224-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Monoamine Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Monoamine Oxidase ELISA kit

E03M0224-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Monoamine Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Monoamine Oxidase ELISA kit

E03M0224-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Monoamine Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Diamine Oxidase ELISA kit

E03D0032-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Diamine Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Diamine Oxidase ELISA kit

E03D0032-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Diamine Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Diamine Oxidase ELISA kit

E03D0032-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Diamine Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

PCYOX1 Blocking Peptide

DF8332-BP 1mg
EUR 195

PCYOX1 Conjugated Antibody

C45274 100ul
EUR 397

PCYOX1 cloning plasmid

CSB-CL017652HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1518
  • Sequence: atggggcgcgtcgtcgcggagcttgtctcctcgctgctggggttgtggctgttgctgtgcagctgcggatgccccgagggcgccgagctgcgtgctccgccagataaaatcgcgattattggagccggaattggtggcacttcagcagcctattacctgcggcagaaatttggga
  • Show more
Description: A cloning plasmid for the PCYOX1 gene.

anti- PCYOX1 antibody

FNab06231 100µg
EUR 505.25
  • Immunogen: prenylcysteine oxidase 1
  • Uniprot ID: Q9UHG3
  • Gene ID: 51449
  • Research Area: Metabolism
Description: Antibody raised against PCYOX1

Anti-PCYOX1 antibody

PAab06231 100 ug
EUR 355

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Mouse NADPH oxidase organizer 1, Noxo1 ELISA KIT

ELI-21241m 96 Tests
EUR 865

Mouse Lysyl Oxidase Like 1 (LOXL1) ELISA Kit

abx575650-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse NADPH oxidase activator 1 (NOXA1) ELISA Kit

abx389985-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse NADPH oxidase organizer 1 (NOXO1) ELISA Kit

abx389986-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse NADPH oxidase activator 1, Noxa1 ELISA KIT

ELI-35317m 96 Tests
EUR 865

ELISA kit for Mouse Sulfhydryl oxidase 1 (QSOX1)

KTE70579-48T 48T
EUR 332
  • Sulfhydryl oxidase 1 is a protein that contains domains of thioredoxin and ERV1, members of two long-standing gene families. The gene expression is induced as fibroblasts begin to exit the proliferative cycle and enter quiescence, suggesting that thi
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Sulfhydryl oxidase 1 (QSOX1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Sulfhydryl oxidase 1 (QSOX1)

KTE70579-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Sulfhydryl oxidase 1 is a protein that contains domains of thioredoxin and ERV1, members of two long-standing gene families. The gene expression is induced as fibroblasts begin to exit the proliferative cycle and enter quiescence, suggesting that thi
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Sulfhydryl oxidase 1 (QSOX1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Sulfhydryl oxidase 1 (QSOX1)

KTE70579-96T 96T
EUR 539
  • Sulfhydryl oxidase 1 is a protein that contains domains of thioredoxin and ERV1, members of two long-standing gene families. The gene expression is induced as fibroblasts begin to exit the proliferative cycle and enter quiescence, suggesting that thi
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Sulfhydryl oxidase 1 (QSOX1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

Noxa1 ELISA Kit| Mouse NADPH oxidase activator 1 ELISA Kit

EF015624 96 Tests
EUR 689

Noxo1 ELISA Kit| Mouse NADPH oxidase organizer 1 ELISA Kit

EF015625 96 Tests
EUR 689

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

Pcyox1 sgRNA CRISPR Lentivector set (Mouse)

K3674501 3 x 1.0 ug
EUR 339

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

AP-STR-KIT-1 1/pk
EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Mouse Spermine Oxidase (SMOX) ELISA Kit

DLR-SMOX-Mu-48T 48T
EUR 527
  • Should the Mouse Spermine Oxidase (SMOX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Spermine Oxidase (SMOX) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Spermine Oxidase (SMOX) ELISA Kit

DLR-SMOX-Mu-96T 96T
EUR 688
  • Should the Mouse Spermine Oxidase (SMOX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Spermine Oxidase (SMOX) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Sulfite Oxidase (SUOX) ELISA Kit

DLR-SUOX-Mu-48T 48T
EUR 527
  • Should the Mouse Sulfite Oxidase (SUOX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Sulfite Oxidase (SUOX) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Sulfite Oxidase (SUOX) ELISA Kit

DLR-SUOX-Mu-96T 96T
EUR 688
  • Should the Mouse Sulfite Oxidase (SUOX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Sulfite Oxidase (SUOX) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Lysyl Oxidase (LOX) ELISA Kit

DLR-LOX-Mu-48T 48T
EUR 527
  • Should the Mouse Lysyl Oxidase (LOX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Lysyl Oxidase (LOX) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Lysyl Oxidase (LOX) ELISA Kit

DLR-LOX-Mu-96T 96T
EUR 688
  • Should the Mouse Lysyl Oxidase (LOX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Lysyl Oxidase (LOX) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Polyamine Oxidase (PAOX) ELISA Kit

DLR-PAOX-Mu-48T 48T
EUR 527
  • Should the Mouse Polyamine Oxidase (PAOX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Polyamine Oxidase (PAOX) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Polyamine Oxidase (PAOX) ELISA Kit

DLR-PAOX-Mu-96T 96T
EUR 688
  • Should the Mouse Polyamine Oxidase (PAOX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Polyamine Oxidase (PAOX) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Acetyl CoA oxidase ELISA kit

E03A0641-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Acetyl CoA oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Acetyl CoA oxidase ELISA kit

E03A0641-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Acetyl CoA oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Acetyl CoA oxidase ELISA kit

E03A0641-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Acetyl CoA oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Xanthine dehydrogenase/oxidase ELISA kit

E03X0012-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Xanthine dehydrogenase/oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Xanthine dehydrogenase/oxidase ELISA kit

E03X0012-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Xanthine dehydrogenase/oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Xanthine dehydrogenase/oxidase ELISA kit

E03X0012-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Xanthine dehydrogenase/oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Monoamine oxidase A ELISA kit

E03M0225-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Monoamine oxidase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Monoamine oxidase A ELISA kit

E03M0225-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Monoamine oxidase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Monoamine oxidase A ELISA kit

E03M0225-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Monoamine oxidase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cytochrome c oxidase ELISA kit

E03C0015-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cytochrome c oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cytochrome c oxidase ELISA kit

E03C0015-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cytochrome c oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cytochrome c oxidase ELISA kit

E03C0015-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cytochrome c oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Aldehyde oxidase(AOX1) ELISA kit

E03A1553-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Aldehyde oxidase(AOX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Aldehyde oxidase(AOX1) ELISA kit

E03A1553-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Aldehyde oxidase(AOX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Aldehyde oxidase(AOX1) ELISA kit

E03A1553-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Aldehyde oxidase(AOX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cytochrome Oxidase 4 ELISA kit

E03C0103-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cytochrome Oxidase 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cytochrome Oxidase 4 ELISA kit

E03C0103-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cytochrome Oxidase 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cytochrome Oxidase 4 ELISA kit

E03C0103-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cytochrome Oxidase 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Lysyl Oxidase (LOX) ELISA Kit

20-abx154350
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Polyamine Oxidase (PAOX) ELISA Kit

20-abx154565
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Spermine Oxidase (SMOX) ELISA Kit

20-abx154701
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Sulfite Oxidase (SUOX) ELISA Kit

20-abx154719
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Spermine oxidase (SMOX) ELISA Kit

abx255097-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.

Mouse Lysyl Oxidase (LOX) ELISA Kit

abx257820-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

ELISA kit for Mouse Spermine oxidase

EK4455 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Spermine oxidase in samples from serum, plasma, tissue homogenates and other biological fluids.

Mouse Smox/ Spermine oxidase ELISA Kit

E1382Mo 1 Kit
EUR 571

Mouse Lathosterol oxidase, Sc5dl ELISA KIT

ELI-20154m 96 Tests
EUR 865

Mouse Sulfite Oxidase, SUOX ELISA Kit

ELI-06779m 96 Tests
EUR 865

Mouse PCYOX1(Prenylcysteine Oxidase 1) ELISA Package