Mouse PCYOX1(Prenylcysteine Oxidase 1) ELISA Kit

Mouse PCYOX1(Prenylcysteine Oxidase 1) ELISA Package

Mouse Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit

RD-PCYOX1-Mu-96Tests 96 Tests
EUR 740

Mouse Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit

RDR-PCYOX1-Mu-48Tests 48 Tests
EUR 557

Mouse Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit

RDR-PCYOX1-Mu-96Tests 96 Tests
EUR 774

Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit

DLR-PCYOX1-Hu-48T 48T
EUR 517
  • Should the Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Prenylcysteine Oxidase 1 (PCYOX1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit

DLR-PCYOX1-Hu-96T 96T
EUR 673
  • Should the Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Prenylcysteine Oxidase 1 (PCYOX1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit

RD-PCYOX1-Hu-48Tests 48 Tests
EUR 521

Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit

RD-PCYOX1-Hu-96Tests 96 Tests
EUR 723

Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit

RDR-PCYOX1-Hu-48Tests 48 Tests
EUR 544

Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit

RDR-PCYOX1-Hu-96Tests 96 Tests
EUR 756

Mouse Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit

20-abx154511
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit

SEH428Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Prenylcysteine Oxidase 1 (PCYOX1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Prenylcysteine Oxidase 1 (PCYOX1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit

SEH428Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Prenylcysteine Oxidase 1 (PCYOX1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Prenylcysteine Oxidase 1 (PCYOX1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit

SEH428Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Prenylcysteine Oxidase 1 (PCYOX1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Prenylcysteine Oxidase 1 (PCYOX1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit

SEH428Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Prenylcysteine Oxidase 1 (PCYOX1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Prenylcysteine Oxidase 1 (PCYOX1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit

4-SEH428Mu
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Prenylcysteine Oxidase 1 elisa. Alternative names of the recognized antigen: PCL1
  • Prenylcysteine lyase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Prenylcysteine Oxidase 1 (PCYOX1) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Prenylcysteine oxidase, Pcyox1 ELISA KIT

ELI-12394m 96 Tests
EUR 865

Prenylcysteine Oxidase 1 (PCYOX1) Antibody

20-abx114673
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Prenylcysteine Oxidase 1 (PCYOX1) Antibody

20-abx131433
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Prenylcysteine Oxidase 1 (PCYOX1) Antibody

20-abx131434
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Prenylcysteine Oxidase 1 (PCYOX1) Antibody

20-abx174153
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Prenylcysteine Oxidase 1 (PCYOX1) Antibody

20-abx178078
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Prenylcysteine Oxidase 1 (PCYOX1) Antibody

20-abx217664
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Prenylcysteine Oxidase 1 (PCYOX1) Antibody

abx340058-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Prenylcysteine Oxidase 1 (PCYOX1) Antibody

abx236231-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Recombinant Prenylcysteine Oxidase 1 (PCYOX1)

4-RPH428Hu01
  • EUR 453.02
  • EUR 224.00
  • EUR 1423.84
  • EUR 541.28
  • EUR 982.56
  • EUR 366.00
  • EUR 3409.60
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9UHG3
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 67.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Prenylcysteine Oxidase 1 expressed in: E.coli

Recombinant Prenylcysteine Oxidase 1 (PCYOX1)

4-RPH428Mu01
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9CQF9
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 32.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Prenylcysteine Oxidase 1 expressed in: E.coli

Mouse Prenylcysteine Oxidase 1 (PCYOX1) Protein

20-abx650731
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Prenylcysteine Oxidase 1 (PCYOX1) CLIA Kit

20-abx495449
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Prenylcysteine oxidase 1, PCYOX1 ELISA KIT

ELI-45170h 96 Tests
EUR 824

Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit

20-abx152665
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Prenylcysteine oxidase 1(PCYOX1) ELISA kit

CSB-EL017652HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Prenylcysteine oxidase 1 (PCYOX1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Prenylcysteine oxidase 1(PCYOX1) ELISA kit

1-CSB-EL017652HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Prenylcysteine oxidase 1(PCYOX1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit

SEH428Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prenylcysteine Oxidase 1 (PCYOX1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prenylcysteine Oxidase 1 (PCYOX1) in Tissue homogenates, cell lysates and other biological fluids.

Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit

SEH428Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prenylcysteine Oxidase 1 (PCYOX1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prenylcysteine Oxidase 1 (PCYOX1) in Tissue homogenates, cell lysates and other biological fluids.

Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit

SEH428Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prenylcysteine Oxidase 1 (PCYOX1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prenylcysteine Oxidase 1 (PCYOX1) in Tissue homogenates, cell lysates and other biological fluids.

Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit

SEH428Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prenylcysteine Oxidase 1 (PCYOX1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prenylcysteine Oxidase 1 (PCYOX1) in Tissue homogenates, cell lysates and other biological fluids.

Human Prenylcysteine Oxidase 1 (PCYOX1) ELISA Kit

4-SEH428Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Prenylcysteine Oxidase 1 elisa. Alternative names of the recognized antigen: PCL1
  • Prenylcysteine lyase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Prenylcysteine Oxidase 1 (PCYOX1) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Mouse PCYOX1 (Prenylcysteine Oxidase 1)

ELK6955 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Prenylcysteine Oxidase 1 (PCYOX1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to
  • Show more
Description: A sandwich ELISA kit for detection of Prenylcysteine Oxidase 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse Prenylcysteine oxidase 1 (PCYOX1)

KTE70784-48T 48T
EUR 332
  • Prenylcysteine is released during the degradation of prenylated proteins. PCYOX1 catalyzes the degradation of prenylcysteine to yield free cysteines and a hydrophobic isoprenoid product . The deduced 505-amino acid protein contains a predicted signal
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Prenylcysteine oxidase 1 (PCYOX1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Prenylcysteine oxidase 1 (PCYOX1)

KTE70784-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Prenylcysteine is released during the degradation of prenylated proteins. PCYOX1 catalyzes the degradation of prenylcysteine to yield free cysteines and a hydrophobic isoprenoid product . The deduced 505-amino acid protein contains a predicted signal
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Prenylcysteine oxidase 1 (PCYOX1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Prenylcysteine oxidase 1 (PCYOX1)

KTE70784-96T 96T
EUR 539
  • Prenylcysteine is released during the degradation of prenylated proteins. PCYOX1 catalyzes the degradation of prenylcysteine to yield free cysteines and a hydrophobic isoprenoid product . The deduced 505-amino acid protein contains a predicted signal
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Prenylcysteine oxidase 1 (PCYOX1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Mouse)

4-PAH428Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCYOX1 (Ala249~Leu505)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prenylcysteine Oxidase 1 (PCYOX1)

Human Prenylcysteine Oxidase 1 (PCYOX1) Protein

20-abx650730
  • EUR 634.00
  • EUR 272.00
  • EUR 1929.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Prenylcysteine Oxidase 1 (PCYOX1) CLIA Kit

20-abx495448
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human PCYOX1 (Prenylcysteine Oxidase 1)

ELK4169 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Prenylcysteine Oxidase 1 (PCYOX1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to
  • Show more
Description: A sandwich ELISA kit for detection of Prenylcysteine Oxidase 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Prenylcysteine oxidase 1 (PCYOX1)

KTE61281-48T 48T
EUR 332
  • Prenylcysteine is released during the degradation of prenylated proteins. PCYOX1 catalyzes the degradation of prenylcysteine to yield free cysteines and a hydrophobic isoprenoid product . The deduced 505-amino acid protein contains a predicted signal
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Prenylcysteine oxidase 1 (PCYOX1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Prenylcysteine oxidase 1 (PCYOX1)

KTE61281-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Prenylcysteine is released during the degradation of prenylated proteins. PCYOX1 catalyzes the degradation of prenylcysteine to yield free cysteines and a hydrophobic isoprenoid product . The deduced 505-amino acid protein contains a predicted signal
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Prenylcysteine oxidase 1 (PCYOX1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Prenylcysteine oxidase 1 (PCYOX1)

KTE61281-96T 96T
EUR 539
  • Prenylcysteine is released during the degradation of prenylated proteins. PCYOX1 catalyzes the degradation of prenylcysteine to yield free cysteines and a hydrophobic isoprenoid product . The deduced 505-amino acid protein contains a predicted signal
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Prenylcysteine oxidase 1 (PCYOX1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Human, Mouse)

4-PAH428Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCYOX1 (Tyr174~Leu505)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Prenylcysteine Oxidase 1 (PCYOX1)

Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Mouse), APC

4-PAH428Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCYOX1 (Ala249~Leu505)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with APC.

Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Mouse), Biotinylated

4-PAH428Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCYOX1 (Ala249~Leu505)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with Biotin.

Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Mouse), Cy3

4-PAH428Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCYOX1 (Ala249~Leu505)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with Cy3.

Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Mouse), FITC

4-PAH428Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCYOX1 (Ala249~Leu505)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with FITC.

Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Mouse), HRP

4-PAH428Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCYOX1 (Ala249~Leu505)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with HRP.

Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Mouse), PE

4-PAH428Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCYOX1 (Ala249~Leu505)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with PE.

Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Human, Mouse), APC

4-PAH428Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCYOX1 (Tyr174~Leu505)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with APC.

Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Human, Mouse), Biotinylated

4-PAH428Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCYOX1 (Tyr174~Leu505)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with Biotin.

Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Human, Mouse), Cy3

4-PAH428Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCYOX1 (Tyr174~Leu505)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with Cy3.

Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Human, Mouse), FITC

4-PAH428Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCYOX1 (Tyr174~Leu505)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with FITC.

Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Human, Mouse), HRP

4-PAH428Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCYOX1 (Tyr174~Leu505)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with HRP.

Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Human, Mouse), PE

4-PAH428Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCYOX1 (Tyr174~Leu505)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with PE.

Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Mouse), APC-Cy7

4-PAH428Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCYOX1 (Ala249~Leu505)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with APC-Cy7.

Prenylcysteine Oxidase 1 (PCYOX1) Polyclonal Antibody (Human, Mouse), APC-Cy7

4-PAH428Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCYOX1 (Tyr174~Leu505)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Prenylcysteine Oxidase 1 (PCYOX1). This antibody is labeled with APC-Cy7.

Mouse Prenylcysteine oxidase- like, Pcyox1l ELISA KIT

ELI-45171m 96 Tests
EUR 865

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Bovine Prenylcysteine oxidase- like, PCYOX1L ELISA KIT

ELI-43159b 96 Tests
EUR 928

Human Prenylcysteine oxidase- like, PCYOX1L ELISA KIT

ELI-43160h 96 Tests
EUR 824

Prenylcysteine Oxidase-Like (PCYXL) Antibody

abx032568-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Prenylcysteine Oxidase-Like (PCYXL) Antibody

abx032568-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Pcyox1/ Rat Pcyox1 ELISA Kit

ELI-14590r 96 Tests
EUR 886

PCYOX1 ELISA KIT|Human

EF001621 96 Tests
EUR 689

Mouse PCYOX1 shRNA Plasmid

20-abx975836
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PCYOX1 Recombinant Protein (Mouse)

RP160775 100 ug Ask for price

PCYOX1 siRNA

20-abx903878
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PCYOX1 siRNA

20-abx928016
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PCYOX1 siRNA

20-abx928017
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PCYOX1 Antibody

ABD8332 100 ug
EUR 438

PCYOX1 Antibody

45274-100ul 100ul
EUR 252

PCYOX1 Antibody

45274-50ul 50ul
EUR 187

PCYOX1 antibody

70R-19165 50 ul
EUR 435
Description: Rabbit polyclonal PCYOX1 antibody

PCYOX1 Antibody

DF8332 200ul
EUR 304
Description: PCYOX1 Antibody detects endogenous levels of total PCYOX1.

PCYOX1 Antibody

1-CSB-PA017652GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PCYOX1. Recognizes PCYOX1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

anti-PCYOX1

YF-PA26185 50 ul
EUR 334
Description: Mouse polyclonal to PCYOX1

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

Pcyox1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3674502 1.0 ug DNA
EUR 154

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Mouse Aldehyde Oxidase 1 (AOX1) ELISA Kit

abx520547-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse NADPH oxidase 1 (NOX1) ELISA Kit

abx520821-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Sulfhydryl Oxidase 1 (QSOX1) ELISA Kit

abx576447-96tests 96 tests
EUR 668
  • Shipped within 1-2 months.

Mouse Dual oxidase 1(DUOX1) ELISA kit

E03D0296-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Dual oxidase 1(DUOX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Dual oxidase 1(DUOX1) ELISA kit

E03D0296-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Dual oxidase 1(DUOX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Dual oxidase 1(DUOX1) ELISA kit

E03D0296-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Dual oxidase 1(DUOX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Quiescin Sulfhydryl Oxidase 1 ELISA kit

E03Q0001-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Quiescin Sulfhydryl Oxidase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Quiescin Sulfhydryl Oxidase 1 ELISA kit

E03Q0001-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Quiescin Sulfhydryl Oxidase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Quiescin Sulfhydryl Oxidase 1 ELISA kit

E03Q0001-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Quiescin Sulfhydryl Oxidase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Sulfhydryl oxidase 1(QSOX1) ELISA kit

E03S0347-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Sulfhydryl oxidase 1(QSOX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Sulfhydryl oxidase 1(QSOX1) ELISA kit

E03S0347-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Sulfhydryl oxidase 1(QSOX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Sulfhydryl oxidase 1(QSOX1) ELISA kit

E03S0347-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Sulfhydryl oxidase 1(QSOX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Mouse NADPH oxidase 1

EK4834 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse NADPH oxidase 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Mouse Nox1/ NADPH oxidase 1 ELISA Kit

E1043Mo 1 Kit
EUR 632

Mouse NADPH oxidase 1, Nox1 ELISA KIT

ELI-07626m 96 Tests
EUR 865

Mouse Hydroxyacid oxidase 1, Hao1 ELISA KIT

ELI-08008m 96 Tests
EUR 865

Mouse Sulfhydryl oxidase 1, Qsox1 ELISA KIT

ELI-43054m 96 Tests
EUR 865

Mouse Nox1(NADPH oxidase 1) ELISA Kit

EM0800 96T
EUR 567.6
  • Detection range: 15.6-1000 pg/ml
  • Uniprot ID: Q8CIZ9
  • Alias: Nox1/NOH-1/Mitogenic oxidase 1(MOX-1)/NADH/NADPH mitogenic oxidase subunit P65-MOX/Nicotinamide Adenine Dinucleotide Phosphate Oxidase 1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 9.375pg/ml

Mouse NADPH Oxidase 1 (NOX1) ELISA Kit

abx255148-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.

Mouse Hydroxyacid oxidase 1(HAO1) ELISA kit

CSB-EL010127MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Hydroxyacid oxidase 1 (HAO1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Hydroxyacid oxidase 1(HAO1) ELISA kit

1-CSB-EL010127MO
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Hydroxyacid oxidase 1(HAO1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Aox1/ Aldehyde oxidase 1 ELISA Kit

E0105Mo 1 Kit
EUR 571

Qsox1 ELISA Kit| Mouse Sulfhydryl oxidase 1 ELISA Kit

EF016016 96 Tests
EUR 689

Nox1 ELISA Kit| Mouse NADPH oxidase 1 ELISA Kit

EF013410 96 Tests
EUR 689

Pcyox1 ORF Vector (Mouse) (pORF)

ORF053593 1.0 ug DNA
EUR 506

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

Mouse Xanthione oxidase ELISA kit

E03X0001-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Xanthione oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Xanthione oxidase ELISA kit

E03X0001-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Xanthione oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Xanthione oxidase ELISA kit

E03X0001-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Xanthione oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Lysyl oxidase ELISA kit

E03L0305-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Lysyl oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Lysyl oxidase ELISA kit

E03L0305-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Lysyl oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Lysyl oxidase ELISA kit

E03L0305-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Lysyl oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Monoamine Oxidase ELISA kit

E03M0224-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Monoamine Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Monoamine Oxidase ELISA kit

E03M0224-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Monoamine Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Monoamine Oxidase ELISA kit

E03M0224-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Monoamine Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Diamine Oxidase ELISA kit

E03D0032-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Diamine Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Diamine Oxidase ELISA kit

E03D0032-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Diamine Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Diamine Oxidase ELISA kit

E03D0032-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Diamine Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Glucose Oxidase ELISA kit

E03G0341-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Glucose Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Glucose Oxidase ELISA kit

E03G0341-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Glucose Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Glucose Oxidase ELISA kit

E03G0341-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Glucose Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

PCYOX1 Conjugated Antibody

C45274 100ul
EUR 397

PCYOX1 cloning plasmid

CSB-CL017652HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1518
  • Sequence: atggggcgcgtcgtcgcggagcttgtctcctcgctgctggggttgtggctgttgctgtgcagctgcggatgccccgagggcgccgagctgcgtgctccgccagataaaatcgcgattattggagccggaattggtggcacttcagcagcctattacctgcggcagaaatttggga
  • Show more
Description: A cloning plasmid for the PCYOX1 gene.

anti- PCYOX1 antibody

FNab06231 100µg
EUR 505.25
  • Immunogen: prenylcysteine oxidase 1
  • Uniprot ID: Q9UHG3
  • Gene ID: 51449
  • Research Area: Metabolism
Description: Antibody raised against PCYOX1

PCYOX1 Blocking Peptide

DF8332-BP 1mg
EUR 195

Anti-PCYOX1 antibody

PAab06231 100 ug
EUR 355

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Mouse Lysyl Oxidase Like 1 (LOXL1) ELISA Kit

abx575650-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse NADPH oxidase organizer 1, Noxo1 ELISA KIT

ELI-21241m 96 Tests
EUR 865

Mouse NADPH oxidase activator 1, Noxa1 ELISA KIT

ELI-35317m 96 Tests
EUR 865

Mouse NADPH oxidase activator 1 (NOXA1) ELISA Kit

abx389985-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse NADPH oxidase organizer 1 (NOXO1) ELISA Kit

abx389986-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

ELISA kit for Mouse Sulfhydryl oxidase 1 (QSOX1)

KTE70579-48T 48T
EUR 332
  • Sulfhydryl oxidase 1 is a protein that contains domains of thioredoxin and ERV1, members of two long-standing gene families. The gene expression is induced as fibroblasts begin to exit the proliferative cycle and enter quiescence, suggesting that thi
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Sulfhydryl oxidase 1 (QSOX1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Sulfhydryl oxidase 1 (QSOX1)

KTE70579-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Sulfhydryl oxidase 1 is a protein that contains domains of thioredoxin and ERV1, members of two long-standing gene families. The gene expression is induced as fibroblasts begin to exit the proliferative cycle and enter quiescence, suggesting that thi
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Sulfhydryl oxidase 1 (QSOX1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Sulfhydryl oxidase 1 (QSOX1)

KTE70579-96T 96T
EUR 539
  • Sulfhydryl oxidase 1 is a protein that contains domains of thioredoxin and ERV1, members of two long-standing gene families. The gene expression is induced as fibroblasts begin to exit the proliferative cycle and enter quiescence, suggesting that thi
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Sulfhydryl oxidase 1 (QSOX1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Noxa1 ELISA Kit| Mouse NADPH oxidase activator 1 ELISA Kit

EF015624 96 Tests
EUR 689

Noxo1 ELISA Kit| Mouse NADPH oxidase organizer 1 ELISA Kit

EF015625 96 Tests
EUR 689

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

Pcyox1 sgRNA CRISPR Lentivector set (Mouse)

K3674501 3 x 1.0 ug
EUR 339

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

AP-STR-KIT-1 1/pk
EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Mouse Spermine oxidase (SMOX) ELISA Kit

abx572544-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Xanthine dehydrogenase/oxidase ELISA kit

E03X0012-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Xanthine dehydrogenase/oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Xanthine dehydrogenase/oxidase ELISA kit

E03X0012-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Xanthine dehydrogenase/oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Xanthine dehydrogenase/oxidase ELISA kit

E03X0012-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Xanthine dehydrogenase/oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Monoamine oxidase A ELISA kit

E03M0225-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Monoamine oxidase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Monoamine oxidase A ELISA kit

E03M0225-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Monoamine oxidase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Monoamine oxidase A ELISA kit

E03M0225-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Monoamine oxidase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cytochrome c oxidase ELISA kit

E03C0015-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cytochrome c oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cytochrome c oxidase ELISA kit

E03C0015-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cytochrome c oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cytochrome c oxidase ELISA kit

E03C0015-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cytochrome c oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cytochrome Oxidase 4 ELISA kit

E03C0103-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cytochrome Oxidase 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cytochrome Oxidase 4 ELISA kit

E03C0103-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cytochrome Oxidase 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cytochrome Oxidase 4 ELISA kit

E03C0103-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cytochrome Oxidase 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Acetyl CoA oxidase ELISA kit

E03A0641-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Acetyl CoA oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Acetyl CoA oxidase ELISA kit

E03A0641-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Acetyl CoA oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Acetyl CoA oxidase ELISA kit

E03A0641-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Acetyl CoA oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Aldehyde oxidase(AOX1) ELISA kit

E03A1553-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Aldehyde oxidase(AOX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Aldehyde oxidase(AOX1) ELISA kit

E03A1553-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Aldehyde oxidase(AOX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Aldehyde oxidase(AOX1) ELISA kit

E03A1553-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Aldehyde oxidase(AOX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Mouse Spermine oxidase

EK4455 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Spermine oxidase in samples from serum, plasma, tissue homogenates and other biological fluids.

Mouse Smox/ Spermine oxidase ELISA Kit

E1382Mo 1 Kit
EUR 571

Mouse Lathosterol oxidase, Sc5dl ELISA KIT

ELI-20154m 96 Tests
EUR 865

Mouse Sulfite Oxidase, SUOX ELISA Kit

ELI-06779m 96 Tests
EUR 865

Mouse Spermine oxidase, Smox ELISA KIT

ELI-07250m 96 Tests
EUR 865

Mouse Aldehyde oxidase, Aox1 ELISA KIT

ELI-07559m 96 Tests
EUR 865

Mouse diamine oxidase(DAO)ELISA Kit    

GA-E0588MS-48T 48T
EUR 336

Mouse diamine oxidase(DAO)ELISA Kit    

GA-E0588MS-96T 96T
EUR 534

Mouse Protoporphyrinogen oxidase, Ppox ELISA KIT

ELI-36548m 96 Tests
EUR 865

Mouse Smox(Spermine oxidase) ELISA Kit

EM0749 96T
EUR 567.6
  • Detection range: 0.312-20 ng/ml
  • Uniprot ID: Q99K82
  • Alias: Smox/SMOX(Spermine oxidase)Polyamine oxidase 1/PAO-1/PAOh1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.188 ng/ml

Mouse DAO(Diamine Oxidase) ELISA Kit

EM0980 96T
EUR 524.1
  • Detection range: 3.906-250 ng/ml
  • Uniprot ID: P18894
  • Alias: DAO/AOC1/DAO/Diamine Oxidase/Histaminase/KAO/ABP/amiloride binding protein 1(amine oxidase(copper-containing))/Amiloride-binding protein/amiloride-sensitive amine oxidase/amiloride-sensitive
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 2.344 ng/ml

Mouse LOX(Lysyl Oxidase) ELISA Kit

EM1614 96T
EUR 567.6
  • Detection range: 0.313-20 ng/ml
  • Alias: Lysyl Oxidase
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.188 ng/ml

Mouse XOD(Xantine oxidase) ELISA Kit

EM1865 96T
EUR 567.6
  • Detection range: 78-5000 pg/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 46.9pg/ml

Mouse Lysyl Oxidase (LOX) ELISA Kit

20-abx154350
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Polyamine Oxidase (PAOX) ELISA Kit

20-abx154565
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Spermine Oxidase (SMOX) ELISA Kit

20-abx154701
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Sulfite Oxidase (SUOX) ELISA Kit

20-abx154719
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Monoamine Oxidase (MAO) ELISA Kit

abx350797-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Mouse Spermine oxidase (SMOX) ELISA Kit

abx255097-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.

Mouse Lysyl Oxidase (LOX) ELISA Kit

abx257820-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Mouse PCYOX1(Prenylcysteine Oxidase 1) ELISA Package