Mouse MSMb(Microseminoprotein Beta) ELISA Equipment
Mouse Microseminoprotein Beta (MSMb) ELISA Kit |
RD-MSMb-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
Mouse Microseminoprotein Beta (MSMb) ELISA Kit |
RDR-MSMb-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Mouse Microseminoprotein Beta (MSMb) ELISA Kit |
RDR-MSMb-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 774 |
Human Microseminoprotein Beta (MSMb) ELISA Kit |
DLR-MSMb-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Microseminoprotein Beta (MSMb) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Microseminoprotein Beta (MSMb) in samples from serum, plasma, seminal plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Microseminoprotein Beta (MSMb) ELISA Kit |
DLR-MSMb-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Microseminoprotein Beta (MSMb) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Microseminoprotein Beta (MSMb) in samples from serum, plasma, seminal plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Microseminoprotein Beta (MSMb) ELISA Kit |
RD-MSMb-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Microseminoprotein Beta (MSMb) ELISA Kit |
RD-MSMb-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Microseminoprotein Beta (MSMb) ELISA Kit |
RDR-MSMb-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Microseminoprotein Beta (MSMb) ELISA Kit |
RDR-MSMb-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Mouse Beta-Microseminoprotein (MSMB) ELISA Kit |
abx571578-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Mouse Msmb/ Beta-microseminoprotein ELISA Kit |
E0972Mo |
Sunlong |
1 Kit |
EUR 632 |
Mouse Beta- microseminoprotein, Msmb ELISA KIT |
ELI-07505m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Microseminoprotein beta (MSMb) ELISA Kit |
20-abx154407 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Microseminoprotein Beta (MSMb) ELISA Kit |
SEC628Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4862.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Microseminoprotein Beta (MSMb) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Microseminoprotein Beta (MSMb) in serum, plasma and other biological fluids. |
Mouse Microseminoprotein Beta (MSMb) ELISA Kit |
SEC628Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 488.08 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Microseminoprotein Beta (MSMb) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Microseminoprotein Beta (MSMb) in serum, plasma and other biological fluids. |
Mouse Microseminoprotein Beta (MSMb) ELISA Kit |
SEC628Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 654.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Microseminoprotein Beta (MSMb) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Microseminoprotein Beta (MSMb) in serum, plasma and other biological fluids. |
Mouse Microseminoprotein Beta (MSMb) ELISA Kit |
SEC628Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2644.8 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Microseminoprotein Beta (MSMb) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Microseminoprotein Beta (MSMb) in serum, plasma and other biological fluids. |
Mouse Microseminoprotein Beta (MSMb) ELISA Kit |
4-SEC628Mu |
Cloud-Clone |
-
EUR 4913.00
-
EUR 2595.00
-
EUR 655.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Microseminoprotein Beta elisa. Alternative names of the recognized antigen: MSM-B
- IGBF
- MSP
- MSPB
- PN44
- PRPS
- PSP
- PSP57
- PSP94
- Immunoglobulin-binding factor
- Prostate secreted seminal plasma protein
- plasma beta-inhibin
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Microseminoprotein Beta (MSMb) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Mouse Microseminoprotein Beta (MSMb) Protein |
20-abx167381 |
Abbexa |
-
EUR 704.00
-
EUR 286.00
-
EUR 2151.00
-
EUR 829.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Mouse Microseminoprotein beta (MSMb) CLIA Kit |
20-abx493808 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Microseminoprotein Beta (MSMB) Antibody |
20-abx113736 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Microseminoprotein Beta (MSMb) Antibody |
20-abx129875 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1233.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Microseminoprotein Beta (MSMB) Antibody |
20-abx136010 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Microseminoprotein Beta (MSMb) Antibody |
20-abx102392 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Microseminoprotein Beta (MSMb) Antibody |
20-abx173566 |
Abbexa |
|
|
|
Microseminoprotein Beta (MSMb) Antibody |
20-abx177557 |
Abbexa |
|
|
|
Microseminoprotein Beta (MSMB) Antibody |
20-abx333960 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Microseminoprotein Beta (MSMB) Protein |
20-abx263042 |
Abbexa |
-
EUR 328.00
-
EUR 7358.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
Microseminoprotein Beta (MSMB) Antibody |
20-abx211136 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Microseminoprotein Beta (MSMB) Antibody |
20-abx211250 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Microseminoprotein Beta (MSMB) Antibody |
20-abx225295 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Recombinant Microseminoprotein Beta (MSMb) |
4-RPC628Hu01 |
Cloud-Clone |
-
EUR 458.40
-
EUR 226.00
-
EUR 1444.00
-
EUR 548.00
-
EUR 996.00
-
EUR 370.00
-
EUR 3460.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P08118
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 16.7kDa
- Isoelectric Point: 5.6
|
Description: Recombinant Human Microseminoprotein Beta expressed in: E.coli |
Recombinant Microseminoprotein Beta (MSMb) |
4-RPC628Mu01 |
Cloud-Clone |
-
EUR 499.62
-
EUR 236.00
-
EUR 1598.56
-
EUR 599.52
-
EUR 1099.04
-
EUR 397.00
-
EUR 3846.40
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: O08540
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 40.7kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Mouse Microseminoprotein Beta expressed in: E.coli |
ELISA kit for Mouse MSMb (Microseminoprotein Beta) |
ELK6939 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Microseminoprotein Beta (MSM?). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Mic
- Show more
|
Description: A sandwich ELISA kit for detection of Microseminoprotein Beta from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Pig Beta-Microseminoprotein (MSMB) ELISA Kit |
abx520327-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Rat Beta-Microseminoprotein (MSMB) ELISA Kit |
abx520328-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Pig Microseminoprotein Beta (MSMb) ELISA Kit |
abx361087-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Rabbit Microseminoprotein Beta (MSMb) ELISA Kit |
abx362965-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Sheep Microseminoprotein Beta (MSMb) ELISA Kit |
abx364138-96tests |
Abbexa |
96 tests |
EUR 926 |
- Shipped within 5-12 working days.
|
Human Beta-Microseminoprotein (MSMB) ELISA Kit |
abx574902-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Rat Msmb/ Beta-microseminoprotein ELISA Kit |
E0637Ra |
Sunlong |
1 Kit |
EUR 646 |
Human MSMB/ Beta-microseminoprotein ELISA Kit |
E1638Hu |
Sunlong |
1 Kit |
EUR 605 |
Human MSMB(Beta-microseminoprotein) ELISA Kit |
EH2282 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 15.625-1000 pg/ml
- Uniprot ID: P08118
- Alias: MSMB/PSP94/IGBF/MSPB/PIP/PN44/PRPS/PSP57
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml |
Porcine Beta- microseminoprotein, MSMB ELISA KIT |
ELI-07504p |
Lifescience Market |
96 Tests |
EUR 928 |
Human Beta- microseminoprotein, MSMB ELISA KIT |
ELI-07506h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Microseminoprotein beta (MSMb) ELISA Kit |
20-abx152383 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Chicken Microseminoprotein Beta (MSMb) ELISA Kit |
abx356068-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Monkey Microseminoprotein Beta (MSMb) ELISA Kit |
abx359299-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Human Microseminoprotein Beta (MSMb) ELISA Kit |
abx251632-96tests |
Abbexa |
96 tests |
EUR 754 |
- Shipped within 5-12 working days.
|
Human Microseminoprotein Beta (MSMb) ELISA Kit |
SEC628Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Microseminoprotein Beta (MSMb) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Microseminoprotein Beta (MSMb) in serum, plasma, seminal plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Microseminoprotein Beta (MSMb) ELISA Kit |
SEC628Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Microseminoprotein Beta (MSMb) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Microseminoprotein Beta (MSMb) in serum, plasma, seminal plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Microseminoprotein Beta (MSMb) ELISA Kit |
SEC628Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Microseminoprotein Beta (MSMb) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Microseminoprotein Beta (MSMb) in serum, plasma, seminal plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Microseminoprotein Beta (MSMb) ELISA Kit |
SEC628Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Microseminoprotein Beta (MSMb) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Microseminoprotein Beta (MSMb) in serum, plasma, seminal plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Microseminoprotein Beta (MSMb) ELISA Kit |
4-SEC628Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Microseminoprotein Beta elisa. Alternative names of the recognized antigen: MSM-B
- IGBF
- MSP
- MSPB
- PN44
- PRPS
- PSP
- PSP57
- PSP94
- Immunoglobulin-binding factor
- Prostate secreted seminal plasma protein
- plasma beta-inhibin
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Microseminoprotein Beta (MSMb) in samples from Serum, plasma, seminal plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Microseminoprotein Beta (MSMb) Polyclonal Antibody (Mouse) |
4-PAC628Mu01 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2576.00
-
EUR 640.00
-
EUR 316.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MSMb (Val21-Met113)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Microseminoprotein Beta (MSMb) |
ELISA kit for Human MSMb (Microseminoprotein Beta) |
ELK3501 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Microseminoprotein Beta (MSM?). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Mic
- Show more
|
Description: A sandwich ELISA kit for detection of Microseminoprotein Beta from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Guinea pig Microseminoprotein Beta (MSMb) ELISA Kit |
abx358166-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Human Beta-microseminoprotein (MSMB/PRSP) ELISA kit |
CSB-E17126h-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Beta-microseminoprotein (MSMB/PRSP) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Beta-microseminoprotein (MSMB/PRSP) ELISA kit |
1-CSB-E17126h |
Cusabio |
-
EUR 900.00
-
EUR 5476.00
-
EUR 2900.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Beta-microseminoprotein (MSMB/PRSP) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Microseminoprotein beta (MSMb) CLIA Kit |
20-abx493807 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Microseminoprotein Beta (MSMb) CLIA Kit |
abx197287-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Human Microseminoprotein Beta (MSMb) Protein |
20-abx068011 |
Abbexa |
-
EUR 648.00
-
EUR 272.00
-
EUR 1943.00
-
EUR 759.00
-
EUR 467.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Microseminoprotein Beta (MSMb) Antibody (FITC) |
20-abx273626 |
Abbexa |
-
EUR 481.00
-
EUR 244.00
-
EUR 1414.00
-
EUR 662.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Microseminoprotein Beta (MSMb) Antibody Pair |
20-abx370275 |
Abbexa |
|
-
10 × 96 tests
-
5 × 96 tests
|
- Shipped within 5-15 working days.
|
Microseminoprotein Beta (MSMB) Antibody (HRP) |
20-abx334839 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Microseminoprotein Beta (MSMB) Antibody (FITC) |
20-abx334840 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Microseminoprotein Beta (MSMB) Antibody (Biotin) |
20-abx334841 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Microseminoprotein Beta (MSMb) Antibody (Biotin) |
20-abx272286 |
Abbexa |
-
EUR 453.00
-
EUR 244.00
-
EUR 1316.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Mouse β microseminoprotein(MSMB) ELISA kit |
E03B0949-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse β microseminoprotein(MSMB) ELISA kit |
E03B0949-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse β microseminoprotein(MSMB) ELISA kit |
E03B0949-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Microseminoprotein Beta (MSMb) Polyclonal Antibody (Mouse), APC |
4-PAC628Mu01-APC |
Cloud-Clone |
-
EUR 351.00
-
EUR 3365.00
-
EUR 935.00
-
EUR 449.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MSMb (Val21-Met113)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Microseminoprotein Beta (MSMb). This antibody is labeled with APC. |
Microseminoprotein Beta (MSMb) Polyclonal Antibody (Mouse), Biotinylated |
4-PAC628Mu01-Biotin |
Cloud-Clone |
-
EUR 316.00
-
EUR 2526.00
-
EUR 744.00
-
EUR 387.00
-
EUR 221.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MSMb (Val21-Met113)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Microseminoprotein Beta (MSMb). This antibody is labeled with Biotin. |
Microseminoprotein Beta (MSMb) Polyclonal Antibody (Mouse), Cy3 |
4-PAC628Mu01-Cy3 |
Cloud-Clone |
-
EUR 427.00
-
EUR 4445.00
-
EUR 1205.00
-
EUR 557.00
-
EUR 254.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MSMb (Val21-Met113)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Microseminoprotein Beta (MSMb). This antibody is labeled with Cy3. |
Microseminoprotein Beta (MSMb) Polyclonal Antibody (Mouse), FITC |
4-PAC628Mu01-FITC |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MSMb (Val21-Met113)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Microseminoprotein Beta (MSMb). This antibody is labeled with FITC. |
Microseminoprotein Beta (MSMb) Polyclonal Antibody (Mouse), HRP |
4-PAC628Mu01-HRP |
Cloud-Clone |
-
EUR 321.00
-
EUR 2933.00
-
EUR 827.00
-
EUR 405.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MSMb (Val21-Met113)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Microseminoprotein Beta (MSMb). This antibody is labeled with HRP. |
Microseminoprotein Beta (MSMb) Polyclonal Antibody (Mouse), PE |
4-PAC628Mu01-PE |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MSMb (Val21-Met113)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Microseminoprotein Beta (MSMb). This antibody is labeled with PE. |
MSMB Beta-Microseminoprotein Human Recombinant Protein |
PROTP08118 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: MSMB Recombinant Human produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 104 amino acids and having a molecular mass of 12 kDa. ;The MSMB is fused to His tag at N-Terminus.;The Human MSMB is purified by proprietary chromatographic techniques. |
Microseminoprotein Beta (MSMb) Polyclonal Antibody (Human) |
4-PAC628Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MSMb (Asn19~Ile114)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Microseminoprotein Beta (MSMb) |
Microseminoprotein Beta (MSMb) Polyclonal Antibody (Mouse), APC-Cy7 |
4-PAC628Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 583.00
-
EUR 6610.00
-
EUR 1750.00
-
EUR 778.00
-
EUR 324.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MSMb (Val21-Met113)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Microseminoprotein Beta (MSMb). This antibody is labeled with APC-Cy7. |
Goat β microseminoprotein(MSMB) ELISA kit |
E06B0949-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat β microseminoprotein(MSMB) ELISA kit |
E06B0949-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat β microseminoprotein(MSMB) ELISA kit |
E06B0949-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat β microseminoprotein(MSMB) ELISA kit |
E02B0949-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat β microseminoprotein(MSMB) ELISA kit |
E02B0949-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat β microseminoprotein(MSMB) ELISA kit |
E02B0949-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human β microseminoprotein(MSMB) ELISA kit |
E01B0949-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human β microseminoprotein(MSMB) ELISA kit |
E01B0949-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human β microseminoprotein(MSMB) ELISA kit |
E01B0949-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit β microseminoprotein(MSMB) ELISA kit |
E04B0949-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit β microseminoprotein(MSMB) ELISA kit |
E04B0949-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit β microseminoprotein(MSMB) ELISA kit |
E04B0949-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig β microseminoprotein(MSMB) ELISA kit |
E07B0949-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig β microseminoprotein(MSMB) ELISA kit |
E07B0949-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig β microseminoprotein(MSMB) ELISA kit |
E07B0949-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey β microseminoprotein(MSMB) ELISA kit |
E09B0949-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey β microseminoprotein(MSMB) ELISA kit |
E09B0949-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey β microseminoprotein(MSMB) ELISA kit |
E09B0949-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog β microseminoprotein(MSMB) ELISA kit |
E08B0949-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog β microseminoprotein(MSMB) ELISA kit |
E08B0949-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog β microseminoprotein(MSMB) ELISA kit |
E08B0949-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Microseminoprotein Beta (MSMb) Polyclonal Antibody (Human), APC |
4-PAC628Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MSMb (Asn19~Ile114)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Microseminoprotein Beta (MSMb). This antibody is labeled with APC. |
Microseminoprotein Beta (MSMb) Polyclonal Antibody (Human), Biotinylated |
4-PAC628Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MSMb (Asn19~Ile114)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Microseminoprotein Beta (MSMb). This antibody is labeled with Biotin. |
Microseminoprotein Beta (MSMb) Polyclonal Antibody (Human), Cy3 |
4-PAC628Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MSMb (Asn19~Ile114)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Microseminoprotein Beta (MSMb). This antibody is labeled with Cy3. |
Microseminoprotein Beta (MSMb) Polyclonal Antibody (Human), FITC |
4-PAC628Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MSMb (Asn19~Ile114)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Microseminoprotein Beta (MSMb). This antibody is labeled with FITC. |
Microseminoprotein Beta (MSMb) Polyclonal Antibody (Human), HRP |
4-PAC628Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MSMb (Asn19~Ile114)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Microseminoprotein Beta (MSMb). This antibody is labeled with HRP. |
Microseminoprotein Beta (MSMb) Polyclonal Antibody (Human), PE |
4-PAC628Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MSMb (Asn19~Ile114)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Microseminoprotein Beta (MSMb). This antibody is labeled with PE. |
Guinea pig β microseminoprotein(MSMB) ELISA kit |
E05B0949-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig β microseminoprotein(MSMB) ELISA kit |
E05B0949-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig β microseminoprotein(MSMB) ELISA kit |
E05B0949-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig β microseminoprotein(MSMB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Microseminoprotein Beta (MSMb) Polyclonal Antibody (Human), APC-Cy7 |
4-PAC628Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MSMb (Asn19~Ile114)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Microseminoprotein Beta (MSMb). This antibody is labeled with APC-Cy7. |
ELISA kit for Human Beta-microseminoprotein |
EK4612 |
SAB |
96 tests |
EUR 603 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Beta-microseminoprotein in samples from serum, plasma, tissue homogenates and other biological fluids. |
ELISA kit for Human MSM? (Microseminoprotein Beta) |
E-EL-H0599 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's MSM? ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human MSM?. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human MSM? (Microseminoprotein Beta) in samples from Serum, Plasma, Cell supernatant |
Recombinant Human Beta-Microseminoprotein |
7-05953 |
CHI Scientific |
2µg |
Ask for price |
Recombinant Human Beta-Microseminoprotein |
7-05954 |
CHI Scientific |
10µg |
Ask for price |
Recombinant Human Beta-Microseminoprotein |
7-05955 |
CHI Scientific |
1mg |
Ask for price |
CLIA kit for Human MSM? (Microseminoprotein Beta) |
E-CL-H0462 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 584 |
- Gentaur's MSM? CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human MSM? . Standards or samples are added to the micro CLIA plate wells and combined with the
- Show more
|
Description: A sandwich CLIA kit for quantitative measurement of Human MSM? (Microseminoprotein Beta) in samples from Serum, Plasma, Cell supernatant |
Mouse Prostate- associated microseminoprotein, Msmp ELISA KIT |
ELI-39235m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Prostate-associated microseminoprotein (MSMP) ELISA Kit |
abx389885-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Msmp ELISA Kit| Mouse Prostate-associated microseminoprotein EL |
EF015522 |
Lifescience Market |
96 Tests |
EUR 689 |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Mouse MSMB shRNA Plasmid |
20-abx971579 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
MSMB Recombinant Protein (Mouse) |
RP151835 |
ABM |
100 ug |
Ask for price |
MSMB siRNA |
20-abx903360 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MSMB siRNA |
20-abx924797 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MSMB siRNA |
20-abx924798 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MSMB Antibody |
32522-100ul |
SAB |
100ul |
EUR 252 |
MSMB antibody |
70R-18647 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal MSMB antibody |
MSMB Antibody |
DF6720 |
Affbiotech |
200ul |
EUR 304 |
Description: MSMB Antibody detects endogenous levels of total MSMB. |
MSMB Antibody |
1-CSB-PA301850 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against MSMB. Recognizes MSMB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200 |
MSMB Antibody |
1-CSB-PA164416 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against MSMB. Recognizes MSMB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100 |
MSMB Antibody |
1-CSB-PA015046GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against MSMB. Recognizes MSMB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC |
MSMB Antibody |
1-CSB-PA015046LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MSMB. Recognizes MSMB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
Human MSMP(Prostate-associated microseminoprotein) ELISA Kit |
EH14901 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.156-10 ng/ml
- Alias: MSMP/PC3-secreted microprotein/PSMP
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Human Prostate- associated microseminoprotein, MSMP ELISA KIT |
ELI-16574h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Prostate-associated microseminoprotein (MSMP) ELISA Kit |
abx385156-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Msmb ORF Vector (Mouse) (pORF) |
ORF050613 |
ABM |
1.0 ug DNA |
EUR 506 |
MSMB Conjugated Antibody |
C32522 |
SAB |
100ul |
EUR 397 |
MSMB cloning plasmid |
CSB-CL015046HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 345
- Sequence: atgaatgttctcctgggcagcgttgtgatctttgccaccttcgtgactttatgcaatgcatcatgctatttcatacctaatgagggagttccaggagattcaaccaggaaatgcatggatctcaaaggaaacaaacacccaataaactcggagtggcagactgacaactgtgagac
- Show more
|
Description: A cloning plasmid for the MSMB gene. |
MSMB Polyclonal Antibody |
ES11068-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MSMB from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
MSMB Polyclonal Antibody |
ES11068-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MSMB from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
MSMB Polyclonal Antibody |
ABP59329-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human MSMB protein
- Applications tips:
|
Description: A polyclonal antibody for detection of MSMB from Human, Mouse, Rat. This MSMB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MSMB protein |
MSMB Polyclonal Antibody |
ABP59329-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human MSMB protein
- Applications tips:
|
Description: A polyclonal antibody for detection of MSMB from Human, Mouse, Rat. This MSMB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MSMB protein |
MSMB Polyclonal Antibody |
ABP59329-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human MSMB protein
- Applications tips:
|
Description: A polyclonal antibody for detection of MSMB from Human, Mouse, Rat. This MSMB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MSMB protein |
MSMB Rabbit pAb |
A10092-100ul |
Abclonal |
100 ul |
EUR 308 |
MSMB Rabbit pAb |
A10092-200ul |
Abclonal |
200 ul |
EUR 459 |
MSMB Rabbit pAb |
A10092-20ul |
Abclonal |
20 ul |
EUR 183 |
MSMB Rabbit pAb |
A10092-50ul |
Abclonal |
50 ul |
EUR 223 |
MSMB Rabbit mAb |
A4168-100ul |
Abclonal |
100 ul |
EUR 410 |
MSMB Rabbit mAb |
A4168-200ul |
Abclonal |
200 ul |
EUR 571 |
MSMB Rabbit mAb |
A4168-20ul |
Abclonal |
20 ul |
EUR 221 |
MSMB Rabbit mAb |
A4168-50ul |
Abclonal |
50 ul |
EUR 287 |
MSMB Rabbit pAb |
A13625-100ul |
Abclonal |
100 ul |
EUR 308 |
MSMB Rabbit pAb |
A13625-200ul |
Abclonal |
200 ul |
EUR 459 |
MSMB Rabbit pAb |
A13625-20ul |
Abclonal |
20 ul |
EUR 183 |
MSMB Rabbit pAb |
A13625-50ul |
Abclonal |
50 ul |
EUR 223 |
MSMB Blocking Peptide |
DF6720-BP |
Affbiotech |
1mg |
EUR 195 |
Anti-MSMB antibody |
STJ112132 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is a member of the immunoglobulin binding factor family. It is synthesized by the epithelial cells of the prostate gland and secreted into the seminal plasma. This protein has inhibin-like activity. It may have a role as an autocrine paracrine factor in uterine, breast and other female reproductive tissues. The expression of the encoded protein is found to be decreased in prostate cancer. Two alternatively spliced transcript variants encoding different isoforms are described for this gene. The use of alternate polyadenylation sites has been found for this gene. |
Anti-MSMB antibody |
STJ192226 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to MSMB |
Anti-MSMB antibody |
STJ115584 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is a member of the immunoglobulin binding factor family. It is synthesized by the epithelial cells of the prostate gland and secreted into the seminal plasma. This protein has inhibin-like activity. It may have a role as an autocrine paracrine factor in uterine, breast and other female reproductive tissues. The expression of the encoded protein is found to be decreased in prostate cancer. Two alternatively spliced transcript variants encoding different isoforms are described for this gene. The use of alternate polyadenylation sites has been found for this gene. |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
Msmb sgRNA CRISPR Lentivector set (Mouse) |
K3408701 |
ABM |
3 x 1.0 ug |
EUR 339 |
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
Rat MSMB shRNA Plasmid |
20-abx985418 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human MSMB shRNA Plasmid |
20-abx952973 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse MSMb(Microseminoprotein Beta) ELISA Equipment