Mouse MID1(Midline 1) ELISA Kit

Mouse MID1(Midline 1) ELISA Package

Mouse Midline 1 (MID1) ELISA Kit

RDR-MID1-Mu-96Tests 96 Tests
EUR 774

Mouse Midline- 1, Mid1 ELISA KIT

ELI-51790m 96 Tests
EUR 865

Mouse Midline 1 (MID1) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Midline-1(MID1) ELISA kit

CSB-EL013819MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Midline-1 (MID1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Midline-1(MID1) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Midline-1(MID1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Midline 1 (MID1) ELISA Kit

SEC620Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Midline 1 (MID1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Midline 1 (MID1) in Tissue homogenates and other biological fluids.

Mouse Midline 1 (MID1) ELISA Kit

SEC620Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Midline 1 (MID1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Midline 1 (MID1) in Tissue homogenates and other biological fluids.

Mouse Midline 1 (MID1) ELISA Kit

SEC620Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Midline 1 (MID1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Midline 1 (MID1) in Tissue homogenates and other biological fluids.

Mouse Midline 1 (MID1) ELISA Kit

SEC620Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Midline 1 (MID1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Midline 1 (MID1) in Tissue homogenates and other biological fluids.

Mouse Midline 1 (MID1) ELISA Kit

  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Midline 1 elisa. Alternative names of the recognized antigen: BBBG1
  • Midin
  • FXY
  • GBBB1
  • OGS1
  • OS
  • OSX
  • RNF59
  • TRIM18
  • XPRF
  • Opitz/BBB Syndrome
  • RING finger protein 59
  • Tripartite motif-containing protein 18
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Midline 1 (MID1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Midline 1 (MID1) Protein

  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

ELISA kit for Mouse MID1 (Midline 1)

ELK7091 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Midline 1 (MID1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Midline 1 (MID1).
  • Show more
Description: A sandwich ELISA kit for detection of Midline 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse Midline-1 (MID1)

KTE71030-48T 48T
EUR 332
  • The protein encoded by MID1 is a member of the tripartite motif (TRIM) family, also known as the 'RING-B box-coiled coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Midline-1 (MID1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Midline-1 (MID1)

KTE71030-5platesof96wells 5 plates of 96 wells
EUR 2115
  • The protein encoded by MID1 is a member of the tripartite motif (TRIM) family, also known as the 'RING-B box-coiled coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Midline-1 (MID1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Midline-1 (MID1)

KTE71030-96T 96T
EUR 539
  • The protein encoded by MID1 is a member of the tripartite motif (TRIM) family, also known as the 'RING-B box-coiled coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Midline-1 (MID1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mouse Midline 1 (MID1) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Midline 1 (MID1) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Midline 1 (MID1) Antibody

abx146040-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Midline 1 (MID1) Antibody

  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Midline 1 (MID1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Midline 1 (MID1) Antibody

abx027403-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Midline 1 (MID1) Antibody

abx027403-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Midline 1 (MID1) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Midline 1 (MID1) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Midline 1 (MID1) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Midline 1 (MID1) Antibody

abx332373-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Recombinant Midline 1 (MID1)

  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O70583
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 27.5KDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Midline 1 expressed in: E.coli

Human Midline- 1, MID1 ELISA KIT

ELI-28917h 96 Tests
EUR 824

Human Midline-1(MID1) ELISA kit

CSB-EL013819HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Midline-1 (MID1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Midline-1(MID1) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Midline-1(MID1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Midline 1(MID1)ELISA Kit

QY-E04797 96T
EUR 394

Midline 1 (MID1) Polyclonal Antibody (Mouse)

  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MID1 (Met1~Leu212)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Midline 1 (MID1)

ELISA kit for Rat Midline-1 (MID1)

KTE100618-48T 48T
EUR 332
  • The protein encoded by MID1 is a member of the tripartite motif (TRIM) family, also known as the 'RING-B box-coiled coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Midline-1 (MID1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Midline-1 (MID1)

KTE100618-5platesof96wells 5 plates of 96 wells
EUR 2115
  • The protein encoded by MID1 is a member of the tripartite motif (TRIM) family, also known as the 'RING-B box-coiled coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Midline-1 (MID1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Midline-1 (MID1)

KTE100618-96T 96T
EUR 539
  • The protein encoded by MID1 is a member of the tripartite motif (TRIM) family, also known as the 'RING-B box-coiled coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Midline-1 (MID1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Midline-1 (MID1)

KTE61623-48T 48T
EUR 332
  • Midline-1 encoded by MID1 is a member of the tripartite motif (TRIM) family, also known as the 'RING-B box-coiled coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box ty
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Midline-1 (MID1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Midline-1 (MID1)

KTE61623-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Midline-1 encoded by MID1 is a member of the tripartite motif (TRIM) family, also known as the 'RING-B box-coiled coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box ty
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Midline-1 (MID1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Midline-1 (MID1)

KTE61623-96T 96T
EUR 539
  • Midline-1 encoded by MID1 is a member of the tripartite motif (TRIM) family, also known as the 'RING-B box-coiled coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box ty
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Midline-1 (MID1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Midline 1 (MID1) polyclonal antibody

ABP-PAB-11697 100 ug Ask for price
    • Product line: Transcription Factors
    • Brand:

Midline 1 (MID1) Polyclonal Antibody (Mouse), APC

  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MID1 (Met1~Leu212)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Midline 1 (MID1). This antibody is labeled with APC.

Midline 1 (MID1) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MID1 (Met1~Leu212)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Midline 1 (MID1). This antibody is labeled with Biotin.

Midline 1 (MID1) Polyclonal Antibody (Mouse), Cy3

  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MID1 (Met1~Leu212)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Midline 1 (MID1). This antibody is labeled with Cy3.

Midline 1 (MID1) Polyclonal Antibody (Mouse), FITC

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MID1 (Met1~Leu212)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Midline 1 (MID1). This antibody is labeled with FITC.

Midline 1 (MID1) Polyclonal Antibody (Mouse), HRP

  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MID1 (Met1~Leu212)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Midline 1 (MID1). This antibody is labeled with HRP.

Midline 1 (MID1) Polyclonal Antibody (Mouse), PE

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MID1 (Met1~Leu212)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Midline 1 (MID1). This antibody is labeled with PE.

Midline 1 (MID1) Polyclonal Antibody (Mouse), APC-Cy7

  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MID1 (Met1~Leu212)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Midline 1 (MID1). This antibody is labeled with APC-Cy7.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Mid1/ Rat Mid1 ELISA Kit

ELI-17080r 96 Tests
EUR 886

Anti-MID1 Antibody

A01774-1 100ug/vial
EUR 334

MID1 ELISA Kit (Mouse) (OKCD08207)

OKCD08207 96 Wells
EUR 1001
Description: Description of target: Has e3 ubiquitin ligase activity towards igbp1, promoting its monoubiquitination, which results in deprotection of the catalytic subunit of protein phosphatase pp2a, and its subsequent degradation by polyubiquitination.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.052ng/mL

MID1 ELISA Kit (Mouse) (OKDD00847)

OKDD00847 96 Wells
EUR 988
Description: Description of target: Has e3 ubiquitin ligase activity towards igbp1, promoting its monoubiquitination, which results in deprotection of the catalytic subunit of protein phosphatase pp2a, and its subsequent degradation by polyubiquitination.;Species reactivity: Mouse;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.052ng/mL

Mouse Mid1- interacting protein 1, Mid1ip1 ELISA KIT

ELI-43013m 96 Tests
EUR 865

Midline-1 Polyclonal Antibody

ES2789-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Midline-1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

Midline-1 Polyclonal Antibody

ES2789-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Midline-1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

Midline-1 Polyclonal Antibody

ABP51790-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human Midline-1 at AA range: 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of Midline-1 from Human, Mouse, Rat. This Midline-1 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human Midline-1 at AA range: 40-120

Midline-1 Polyclonal Antibody

ABP51790-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human Midline-1 at AA range: 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of Midline-1 from Human, Mouse, Rat. This Midline-1 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human Midline-1 at AA range: 40-120

Midline-1 Polyclonal Antibody

ABP51790-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human Midline-1 at AA range: 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of Midline-1 from Human, Mouse, Rat. This Midline-1 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human Midline-1 at AA range: 40-120

Anti-Midline-1 antibody

STJ94125 200 µl
EUR 197
Description: Rabbit polyclonal to Midline-1.

Human Midline 2(MID2)ELISA Kit

QY-E04796 96T
EUR 394

MID1 ELISA Kit (Human) (OKCA00727)

OKCA00727 96 Wells
EUR 833
Description: Description of target: Has E3 ubiquitin ligase activity towards IGBP1, promoting its monoubiquitination, which results in deprotection of the catalytic subunit of protein phosphatase PP2A, and its subsequent degradation by polyubiquitination.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 5.86 pg/mL

Human Mid1- interacting protein 1, MID1IP1 ELISA KIT

ELI-31441h 96 Tests
EUR 824

Human MID1 Interacting Protein 1 (MID1IP1) ELISA Kit

abx381447-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse MID1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MID1 Recombinant Protein (Mouse)

RP150623 100 ug Ask for price

MID1 Recombinant Protein (Mouse)

RP150626 100 ug Ask for price


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MID1 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against MID1. Recognizes MID1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/40000

MID1 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MID1. Recognizes MID1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

MID1 Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against MID1. Recognizes MID1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500

MID1 Antibody

CSB-PA188851-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against MID1. Recognizes MID1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500


YF-PA24154 50 ul
EUR 334
Description: Mouse polyclonal to MID1

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Mid1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3974902 1.0 ug DNA
EUR 154

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

ELISA kit for Rat Mid1-interacting protein 1 (MID1IP1)

KTE100617-48T 48T
EUR 332
  • MID1IP1 (MID1 Interacting Protein 1) is a Protein Coding gene. Among its related pathways are Metabolism and Import of palmitoyl-CoA into the mitochondrial matrix. GO annotations related to this gene include protein C-terminus binding. An important p
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Mid1-interacting protein 1 (MID1IP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Mid1-interacting protein 1 (MID1IP1)

KTE100617-5platesof96wells 5 plates of 96 wells
EUR 2115
  • MID1IP1 (MID1 Interacting Protein 1) is a Protein Coding gene. Among its related pathways are Metabolism and Import of palmitoyl-CoA into the mitochondrial matrix. GO annotations related to this gene include protein C-terminus binding. An important p
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Mid1-interacting protein 1 (MID1IP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Mid1-interacting protein 1 (MID1IP1)

KTE100617-96T 96T
EUR 539
  • MID1IP1 (MID1 Interacting Protein 1) is a Protein Coding gene. Among its related pathways are Metabolism and Import of palmitoyl-CoA into the mitochondrial matrix. GO annotations related to this gene include protein C-terminus binding. An important p
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Mid1-interacting protein 1 (MID1IP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Mid1-interacting protein 1 (MID1IP1)

KTE61622-48T 48T
EUR 332
  • MID1IP1 (MID1 Interacting Protein 1) is a Protein Coding gene. Among its related pathways are Metabolism and Import of palmitoyl-CoA into the mitochondrial matrix. GO annotations related to this gene include protein C-terminus binding. An important p
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Mid1-interacting protein 1 (MID1IP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Mid1-interacting protein 1 (MID1IP1)

KTE61622-5platesof96wells 5 plates of 96 wells
EUR 2115
  • MID1IP1 (MID1 Interacting Protein 1) is a Protein Coding gene. Among its related pathways are Metabolism and Import of palmitoyl-CoA into the mitochondrial matrix. GO annotations related to this gene include protein C-terminus binding. An important p
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Mid1-interacting protein 1 (MID1IP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Mid1-interacting protein 1 (MID1IP1)

KTE61622-96T 96T
EUR 539
  • MID1IP1 (MID1 Interacting Protein 1) is a Protein Coding gene. Among its related pathways are Metabolism and Import of palmitoyl-CoA into the mitochondrial matrix. GO annotations related to this gene include protein C-terminus binding. An important p
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Mid1-interacting protein 1 (MID1IP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mid1 ORF Vector (Mouse) (pORF)

ORF050209 1.0 ug DNA
EUR 506

Mid1 ORF Vector (Mouse) (pORF)

ORF050210 1.0 ug DNA
EUR 506

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

MID1 cloning plasmid

CSB-CL013819HU-10ug 10ug
EUR 671
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2004
  • Sequence: atggaaacactggagtcagaactgacctgccctatttgtctggagctctttgaggaccctcttctactgccctgcgcacacagcctctgcttcaactgcgcccaccgcatcctagtatcacactgtgccaccaacgagtctgtggagtccatcaccgccttccagtgccccacct
  • Show more
Description: A cloning plasmid for the MID1 gene.

MID1 Blocking Peptide

  • EUR 258.00
  • EUR 384.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

MID1 Rabbit pAb

A7291-100ul 100 ul
EUR 308

MID1 Rabbit pAb

A7291-200ul 200 ul
EUR 459

MID1 Rabbit pAb

A7291-20ul 20 ul
EUR 183

MID1 Rabbit pAb

A7291-50ul 50 ul
EUR 223

MID1 Polyclonal Antibody

30882-100ul 100ul
EUR 252

MID1 Polyclonal Antibody

30882-50ul 50ul
EUR 187

Anti-MID1 antibody

STJ29430 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the tripartite motif (TRIM) family, also known as the 'RING-B box-coiled coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This protein forms homodimers which associate with microtubules in the cytoplasm. The protein is likely involved in the formation of multiprotein structures acting as anchor points to microtubules. Mutations in this gene have been associated with the X-linked form of Opitz syndrome, which is characterized by midline abnormalities such as cleft lip, laryngeal cleft, heart defects, hypospadias, and agenesis of the corpus callosum. This gene was also the first example of a gene subject to X inactivation in human while escaping it in mouse. Alternative promoter use, alternative splicing and alternative polyadenylation result in multiple transcript variants that have different tissue specificities.

Anti-MID1 (2C11)

YF-MA14254 100 ug
EUR 363
Description: Mouse monoclonal to MID1

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

Mouse MID1(Midline 1) ELISA Package