Mouse MID1(Midline 1) ELISA Package
Mouse Midline 1 (MID1) ELISA Kit |
RD-MID1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
Mouse Midline-1(MID1) ELISA kit |
CSB-EL013819MO-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Midline-1 (MID1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Mouse Midline-1(MID1) ELISA kit |
1-CSB-EL013819MO |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Midline-1(MID1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Mouse Midline 1 (MID1) ELISA Kit |
20-abx154383 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Midline 1 (MID1) ELISA Kit |
SEC620Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4862.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Midline 1 (MID1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Midline 1 (MID1) in Tissue homogenates and other biological fluids. |
Mouse Midline 1 (MID1) ELISA Kit |
SEC620Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 488.08 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Midline 1 (MID1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Midline 1 (MID1) in Tissue homogenates and other biological fluids. |
Mouse Midline 1 (MID1) ELISA Kit |
SEC620Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 654.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Midline 1 (MID1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Midline 1 (MID1) in Tissue homogenates and other biological fluids. |
Mouse Midline 1 (MID1) ELISA Kit |
SEC620Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2644.8 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Midline 1 (MID1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Midline 1 (MID1) in Tissue homogenates and other biological fluids. |
Mouse Midline 1 (MID1) ELISA Kit |
4-SEC620Mu |
Cloud-Clone |
-
EUR 4913.00
-
EUR 2595.00
-
EUR 655.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Midline 1 elisa. Alternative names of the recognized antigen: BBBG1
- Midin
- FXY
- GBBB1
- OGS1
- OS
- OSX
- RNF59
- TRIM18
- XPRF
- ZNFXY
- Opitz/BBB Syndrome
- RING finger protein 59
- Tripartite motif-containing protein 18
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Midline 1 (MID1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
ELISA kit for Mouse MID1 (Midline 1) |
ELK7091 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Midline 1 (MID1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Midline 1 (MID1).
- Show more
|
Description: A sandwich ELISA kit for detection of Midline 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Mouse Midline-1 (MID1) |
KTE71030-48T |
Abbkine |
48T |
EUR 332 |
- The protein encoded by MID1 is a member of the tripartite motif (TRIM) family, also known as the 'RING-B box-coiled coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Midline-1 (MID1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Midline-1 (MID1) |
KTE71030-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- The protein encoded by MID1 is a member of the tripartite motif (TRIM) family, also known as the 'RING-B box-coiled coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Midline-1 (MID1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Midline-1 (MID1) |
KTE71030-96T |
Abbkine |
96T |
EUR 539 |
- The protein encoded by MID1 is a member of the tripartite motif (TRIM) family, also known as the 'RING-B box-coiled coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Midline-1 (MID1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Mouse Midline 1 (MID1) CLIA Kit |
20-abx493802 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Mouse Midline 1 (MID1) Protein |
20-abx167423 |
Abbexa |
-
EUR 704.00
-
EUR 286.00
-
EUR 2165.00
-
EUR 829.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Midline-1(MID1) ELISA kit |
CSB-EL013819HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Midline-1 (MID1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Midline-1(MID1) ELISA kit |
1-CSB-EL013819HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Midline-1(MID1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Midline 1 (MID1) Antibody |
20-abx005498 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Midline 1 (MID1) Antibody |
abx027403-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Midline 1 (MID1) Antibody |
abx027403-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Midline 1 (MID1) Antibody |
20-abx177566 |
Abbexa |
|
|
|
Midline 1 (MID1) Antibody |
20-abx129420 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1233.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Midline 1 (MID1) Antibody |
20-abx134929 |
Abbexa |
-
EUR 356.00
-
EUR 537.00
-
EUR 217.00
|
|
- Shipped within 5-10 working days.
|
Midline 1 (MID1) Antibody |
abx146040-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Midline 1 (MID1) Antibody |
20-abx320825 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Midline 1 (MID1) Antibody |
20-abx329554 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Midline 1 (MID1) Antibody |
abx332373-100ul |
Abbexa |
100 ul |
EUR 425 |
- Shipped within 5-10 working days.
|
Recombinant Midline 1 (MID1) |
4-RPC620Mu01 |
Cloud-Clone |
-
EUR 503.20
-
EUR 238.00
-
EUR 1612.00
-
EUR 604.00
-
EUR 1108.00
-
EUR 400.00
-
EUR 3880.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: O70583
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 27.5KDa
- Isoelectric Point: Inquire
|
Description: Recombinant Mouse Midline 1 expressed in: E.coli |
Midline 1 (MID1) Polyclonal Antibody (Mouse) |
4-PAC620Mu01 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2576.00
-
EUR 640.00
-
EUR 316.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MID1 (Met1~Leu212)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Midline 1 (MID1) |
ELISA kit for Rat Midline-1 (MID1) |
KTE100618-48T |
Abbkine |
48T |
EUR 332 |
- The protein encoded by MID1 is a member of the tripartite motif (TRIM) family, also known as the 'RING-B box-coiled coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Midline-1 (MID1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Midline-1 (MID1) |
KTE100618-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- The protein encoded by MID1 is a member of the tripartite motif (TRIM) family, also known as the 'RING-B box-coiled coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Midline-1 (MID1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Midline-1 (MID1) |
KTE100618-96T |
Abbkine |
96T |
EUR 539 |
- The protein encoded by MID1 is a member of the tripartite motif (TRIM) family, also known as the 'RING-B box-coiled coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Midline-1 (MID1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Midline-1 (MID1) |
KTE61623-48T |
Abbkine |
48T |
EUR 332 |
- Midline-1 encoded by MID1 is a member of the tripartite motif (TRIM) family, also known as the 'RING-B box-coiled coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box ty
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Midline-1 (MID1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Midline-1 (MID1) |
KTE61623-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Midline-1 encoded by MID1 is a member of the tripartite motif (TRIM) family, also known as the 'RING-B box-coiled coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box ty
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Midline-1 (MID1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Midline-1 (MID1) |
KTE61623-96T |
Abbkine |
96T |
EUR 539 |
- Midline-1 encoded by MID1 is a member of the tripartite motif (TRIM) family, also known as the 'RING-B box-coiled coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box ty
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Midline-1 (MID1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Midline 1 (MID1) polyclonal antibody |
ABP-PAB-11697 |
Allele Biotech |
100 ug |
Ask for price |
- Product line: Transcription Factors
- Brand:
|
Midline 1 (MID1) Polyclonal Antibody (Mouse), APC |
4-PAC620Mu01-APC |
Cloud-Clone |
-
EUR 351.00
-
EUR 3365.00
-
EUR 935.00
-
EUR 449.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MID1 (Met1~Leu212)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Midline 1 (MID1). This antibody is labeled with APC. |
Midline 1 (MID1) Polyclonal Antibody (Mouse), Biotinylated |
4-PAC620Mu01-Biotin |
Cloud-Clone |
-
EUR 316.00
-
EUR 2526.00
-
EUR 744.00
-
EUR 387.00
-
EUR 221.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MID1 (Met1~Leu212)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Midline 1 (MID1). This antibody is labeled with Biotin. |
Midline 1 (MID1) Polyclonal Antibody (Mouse), Cy3 |
4-PAC620Mu01-Cy3 |
Cloud-Clone |
-
EUR 427.00
-
EUR 4445.00
-
EUR 1205.00
-
EUR 557.00
-
EUR 254.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MID1 (Met1~Leu212)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Midline 1 (MID1). This antibody is labeled with Cy3. |
Midline 1 (MID1) Polyclonal Antibody (Mouse), FITC |
4-PAC620Mu01-FITC |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MID1 (Met1~Leu212)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Midline 1 (MID1). This antibody is labeled with FITC. |
Midline 1 (MID1) Polyclonal Antibody (Mouse), HRP |
4-PAC620Mu01-HRP |
Cloud-Clone |
-
EUR 321.00
-
EUR 2933.00
-
EUR 827.00
-
EUR 405.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MID1 (Met1~Leu212)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Midline 1 (MID1). This antibody is labeled with HRP. |
Midline 1 (MID1) Polyclonal Antibody (Mouse), PE |
4-PAC620Mu01-PE |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MID1 (Met1~Leu212)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Midline 1 (MID1). This antibody is labeled with PE. |
Midline 1 (MID1) Polyclonal Antibody (Mouse), APC-Cy7 |
4-PAC620Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 583.00
-
EUR 6610.00
-
EUR 1750.00
-
EUR 778.00
-
EUR 324.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MID1 (Met1~Leu212)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Midline 1 (MID1). This antibody is labeled with APC-Cy7. |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Anti-MID1 Antibody |
A01774-1 |
BosterBio |
100ug/vial |
EUR 334 |
Mouse Mid1- interacting protein 1, Mid1ip1 ELISA KIT |
ELI-43013m |
Lifescience Market |
96 Tests |
EUR 865 |
Midline-1 Polyclonal Antibody |
ABP51790-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from the N-terminal region of human Midline-1 at AA range: 40-120
- Applications tips:
|
Description: A polyclonal antibody for detection of Midline-1 from Human, Mouse, Rat. This Midline-1 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human Midline-1 at AA range: 40-120 |
Midline-1 Polyclonal Antibody |
ABP51790-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from the N-terminal region of human Midline-1 at AA range: 40-120
- Applications tips:
|
Description: A polyclonal antibody for detection of Midline-1 from Human, Mouse, Rat. This Midline-1 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human Midline-1 at AA range: 40-120 |
Midline-1 Polyclonal Antibody |
ABP51790-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from the N-terminal region of human Midline-1 at AA range: 40-120
- Applications tips:
|
Description: A polyclonal antibody for detection of Midline-1 from Human, Mouse, Rat. This Midline-1 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human Midline-1 at AA range: 40-120 |
Midline-1 Polyclonal Antibody |
ES2789-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Midline-1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA |
Midline-1 Polyclonal Antibody |
ES2789-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Midline-1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA |
Anti-Midline-1 antibody |
STJ94125 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to Midline-1. |
Human Mid1- interacting protein 1, MID1IP1 ELISA KIT |
ELI-31441h |
Lifescience Market |
96 Tests |
EUR 824 |
Human MID1 Interacting Protein 1 (MID1IP1) ELISA Kit |
abx381447-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse MID1 shRNA Plasmid |
20-abx971511 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
MID1 Recombinant Protein (Mouse) |
RP150623 |
ABM |
100 ug |
Ask for price |
MID1 Recombinant Protein (Mouse) |
RP150626 |
ABM |
100 ug |
Ask for price |
MID1 Antibody |
1-CSB-PA003239 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against MID1. Recognizes MID1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/40000 |
MID1 Antibody |
CSB-PA188851- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against MID1. Recognizes MID1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500 |
MID1 Antibody |
CSB-PA188851-100ul |
Cusabio |
100ul |
EUR 316 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against MID1. Recognizes MID1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500 |
MID1 Antibody |
1-CSB-PA013819ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against MID1. Recognizes MID1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
MID1 siRNA |
20-abx903258 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MID1 siRNA |
20-abx924146 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MID1 siRNA |
20-abx924147 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-MID1 |
YF-PA24154 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to MID1 |
mRNAExpress mRNA Synthesis kit (5 reactions) |
MR-KIT-1 |
SBI |
5 reactions |
EUR 1152 |
- Category: Stem Cell Products
|
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN320A-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN340iPS-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
Mid1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3974902 |
ABM |
1.0 ug DNA |
EUR 154 |
ELISA kit for Rat Mid1-interacting protein 1 (MID1IP1) |
KTE100617-48T |
Abbkine |
48T |
EUR 332 |
- MID1IP1 (MID1 Interacting Protein 1) is a Protein Coding gene. Among its related pathways are Metabolism and Import of palmitoyl-CoA into the mitochondrial matrix. GO annotations related to this gene include protein C-terminus binding. An important p
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Mid1-interacting protein 1 (MID1IP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Mid1-interacting protein 1 (MID1IP1) |
KTE100617-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- MID1IP1 (MID1 Interacting Protein 1) is a Protein Coding gene. Among its related pathways are Metabolism and Import of palmitoyl-CoA into the mitochondrial matrix. GO annotations related to this gene include protein C-terminus binding. An important p
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Mid1-interacting protein 1 (MID1IP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Mid1-interacting protein 1 (MID1IP1) |
KTE100617-96T |
Abbkine |
96T |
EUR 539 |
- MID1IP1 (MID1 Interacting Protein 1) is a Protein Coding gene. Among its related pathways are Metabolism and Import of palmitoyl-CoA into the mitochondrial matrix. GO annotations related to this gene include protein C-terminus binding. An important p
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Mid1-interacting protein 1 (MID1IP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Mid1-interacting protein 1 (MID1IP1) |
KTE61622-48T |
Abbkine |
48T |
EUR 332 |
- MID1IP1 (MID1 Interacting Protein 1) is a Protein Coding gene. Among its related pathways are Metabolism and Import of palmitoyl-CoA into the mitochondrial matrix. GO annotations related to this gene include protein C-terminus binding. An important p
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Mid1-interacting protein 1 (MID1IP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Mid1-interacting protein 1 (MID1IP1) |
KTE61622-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- MID1IP1 (MID1 Interacting Protein 1) is a Protein Coding gene. Among its related pathways are Metabolism and Import of palmitoyl-CoA into the mitochondrial matrix. GO annotations related to this gene include protein C-terminus binding. An important p
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Mid1-interacting protein 1 (MID1IP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Mid1-interacting protein 1 (MID1IP1) |
KTE61622-96T |
Abbkine |
96T |
EUR 539 |
- MID1IP1 (MID1 Interacting Protein 1) is a Protein Coding gene. Among its related pathways are Metabolism and Import of palmitoyl-CoA into the mitochondrial matrix. GO annotations related to this gene include protein C-terminus binding. An important p
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Mid1-interacting protein 1 (MID1IP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Mid1 ORF Vector (Mouse) (pORF) |
ORF050209 |
ABM |
1.0 ug DNA |
EUR 506 |
Mid1 ORF Vector (Mouse) (pORF) |
ORF050210 |
ABM |
1.0 ug DNA |
EUR 506 |
ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody |
EXOAB-KIT-1 |
SBI |
25 ul each |
EUR 627 |
|
PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN300A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents) |
CAS510A-KIT |
SBI |
1 Kit |
EUR 805 |
|
MID1 Polyclonal Antibody |
30882-100ul |
SAB |
100ul |
EUR 252 |
MID1 Polyclonal Antibody |
30882-50ul |
SAB |
50ul |
EUR 187 |
MID1 Blocking Peptide |
20-abx061628 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MID1 cloning plasmid |
CSB-CL013819HU-10ug |
Cusabio |
10ug |
EUR 671 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2004
- Sequence: atggaaacactggagtcagaactgacctgccctatttgtctggagctctttgaggaccctcttctactgccctgcgcacacagcctctgcttcaactgcgcccaccgcatcctagtatcacactgtgccaccaacgagtctgtggagtccatcaccgccttccagtgccccacct
- Show more
|
Description: A cloning plasmid for the MID1 gene. |
MID1 Rabbit pAb |
A7291-100ul |
Abclonal |
100 ul |
EUR 308 |
MID1 Rabbit pAb |
A7291-200ul |
Abclonal |
200 ul |
EUR 459 |
MID1 Rabbit pAb |
A7291-20ul |
Abclonal |
20 ul |
EUR 183 |
MID1 Rabbit pAb |
A7291-50ul |
Abclonal |
50 ul |
EUR 223 |
Anti-MID1 antibody |
STJ29430 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is a member of the tripartite motif (TRIM) family, also known as the 'RING-B box-coiled coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This protein forms homodimers which associate with microtubules in the cytoplasm. The protein is likely involved in the formation of multiprotein structures acting as anchor points to microtubules. Mutations in this gene have been associated with the X-linked form of Opitz syndrome, which is characterized by midline abnormalities such as cleft lip, laryngeal cleft, heart defects, hypospadias, and agenesis of the corpus callosum. This gene was also the first example of a gene subject to X inactivation in human while escaping it in mouse. Alternative promoter use, alternative splicing and alternative polyadenylation result in multiple transcript variants that have different tissue specificities. |
Anti-MID1 (2C11) |
YF-MA14254 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to MID1 |
PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN400A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN410A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN412A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
MID1 Interacting Protein 1 (MID1IP1) Antibody |
20-abx216857 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MID1 Interacting Protein 1 (MID1IP1) Antibody |
20-abx121163 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Mouse MID1(Midline 1) ELISA Package