Mouse FXN(Frataxin) ELISA Kit

Mouse FXN(Frataxin) ELISA Equipment

Mouse Frataxin (FXN) ELISA Kit

  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Frataxin elisa. Alternative names of the recognized antigen: FA
  • CyaY
  • FARR
  • FRDA
  • X25
  • Friedreich ataxia protein
  • Frataxin intermediate form
  • Frataxin, mitochondrial
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Frataxin (FXN) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Frataxin ELISA Kit (FXN)

RK02825 96 Tests
EUR 521

Mouse Frataxin, mitochondrial, Fxn ELISA KIT

ELI-26735m 96 Tests
EUR 865

ELISA kit for Mouse FXN (Frataxin)

ELK7258 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Frataxin (FXN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Frataxin (FXN). Nex
  • Show more
Description: A sandwich ELISA kit for detection of Frataxin from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Mouse Frataxin (FXN) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Frataxin (FXN) Protein

  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Frataxin, mitochondrial (Fxn)

  • EUR 504.00
  • EUR 265.00
  • EUR 1832.00
  • EUR 763.00
  • EUR 1216.00
  • EUR 334.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 16.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Frataxin, mitochondrial(Fxn) expressed in Yeast

Mouse Frataxin, mitochondrial (Fxn)

  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 30.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Frataxin, mitochondrial(Fxn) expressed in E.coli

Mouse Frataxin, mitochondrial (Fxn)

  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 19.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Frataxin,mitochondrial(Fxn) expressed in E.coli

Human Frataxin (FXN) ELISA Kit

abx351823-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Rat Frataxin (FXN) ELISA Kit

abx391355-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Frataxin(FXN)ELISA Kit

QY-E04922 96T
EUR 361

Frataxin (FXN) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Frataxin (FXN) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Frataxin (FXN) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Frataxin (FXN) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Frataxin (FXN) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Frataxin (FXN) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Frataxin (FXN) Antibody

abx032827-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Frataxin (FXN) Antibody

abx032827-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Frataxin (FXN) Antibody

abx032828-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Frataxin (FXN) Antibody

abx032828-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Frataxin (FXN) Antibody

abx031313-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Frataxin (FXN) Antibody

abx031313-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Frataxin (FXN) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Frataxin (FXN) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Frataxin (FXN) Antibody

abx233255-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Recombinant Frataxin (FXN)

  • EUR 449.44
  • EUR 223.00
  • EUR 1410.40
  • EUR 536.80
  • EUR 973.60
  • EUR 364.00
  • EUR 3376.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q16595
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 19.8kDa
  • Isoelectric Point: 6.8
Description: Recombinant Human Frataxin expressed in: E.coli

Recombinant Frataxin (FXN)

  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O35943
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 22.4kDa
  • Isoelectric Point: 6.4
Description: Recombinant Mouse Frataxin expressed in: E.coli

Rat Fxn/ Frataxin, mitochondrial ELISA Kit

E0377Ra 1 Kit
EUR 646

Human Frataxin, mitochondrial, FXN ELISA KIT

ELI-27579h 96 Tests
EUR 824

Bovine Frataxin, mitochondrial, FXN ELISA KIT

ELI-47324b 96 Tests
EUR 928

ELISA kit for Human FXN (Frataxin)

E-EL-H1634 1 plate of 96 wells
EUR 534
  • Gentaur's FXN ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human FXN. Standards or samples are added to the micro ELISA plate wells and combined with the
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human FXN (Frataxin) in samples from Serum, Plasma, Cell supernatant

Mouse Frataxin (FXN) control peptide

FXN11-P 100 ug
EUR 164

Frataxin (FXN) Polyclonal Antibody (Mouse)

  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FXN (Leu41~Thr207)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Frataxin (FXN)

Human Frataxin (FXN) Protein

  • EUR 634.00
  • EUR 272.00
  • EUR 1901.00
  • EUR 746.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Frataxin (FXN) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Frataxin (FXN) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Frataxin (FXN) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

FXN / Frataxin Rabbit pAb

A11785-100ul 100 ul
EUR 308

FXN / Frataxin Rabbit pAb

A11785-200ul 200 ul
EUR 459

FXN / Frataxin Rabbit pAb

A11785-20ul 20 ul
EUR 183

FXN / Frataxin Rabbit pAb

A11785-50ul 50 ul
EUR 223

FXN / Frataxin Rabbit pAb

A1745-100ul 100 ul
EUR 308

FXN / Frataxin Rabbit pAb

A1745-200ul 200 ul
EUR 459

FXN / Frataxin Rabbit pAb

A1745-20ul 20 ul
EUR 183

FXN / Frataxin Rabbit pAb

A1745-50ul 50 ul
EUR 223

FXN / Frataxin Polyclonal Antibody

27571-100ul 100ul
EUR 252

FXN / Frataxin Polyclonal Antibody

27571-50ul 50ul
EUR 187

Rat Frataxin, mitochondrial (Fxn)

  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 22.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Frataxin, mitochondrial(Fxn) expressed in E.coli

Rat Frataxin, mitochondrial (Fxn)

  • EUR 621.00
  • EUR 381.00
  • EUR 1943.00
  • EUR 882.00
  • EUR 1335.00
  • EUR 451.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 18.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Frataxin, mitochondrial(Fxn) expressed in E.coli

Human Frataxin, mitochondrial (FXN)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 43.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Frataxin, mitochondrial(FXN) expressed in E.coli

Human Frataxin, mitochondrial (FxN)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 28.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Frataxin, mitochondrial(FxN) expressed in E.coli

Rabbit Anti-Mouse Frataxin (FXN) antiserum

FXN11-S 100 ul
EUR 457

Frataxin (FXN) Polyclonal Antibody (Mouse), APC

  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FXN (Leu41~Thr207)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Frataxin (FXN). This antibody is labeled with APC.

Frataxin (FXN) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FXN (Leu41~Thr207)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Frataxin (FXN). This antibody is labeled with Biotin.

Frataxin (FXN) Polyclonal Antibody (Mouse), Cy3

  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FXN (Leu41~Thr207)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Frataxin (FXN). This antibody is labeled with Cy3.

Frataxin (FXN) Polyclonal Antibody (Mouse), FITC

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FXN (Leu41~Thr207)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Frataxin (FXN). This antibody is labeled with FITC.

Frataxin (FXN) Polyclonal Antibody (Mouse), HRP

  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FXN (Leu41~Thr207)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Frataxin (FXN). This antibody is labeled with HRP.

Frataxin (FXN) Polyclonal Antibody (Mouse), PE

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FXN (Leu41~Thr207)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Frataxin (FXN). This antibody is labeled with PE.

FXN / Frataxin Polyclonal Conjugated Antibody

C29936 100ul
EUR 397

FXN / Frataxin Polyclonal Conjugated Antibody

C27571 100ul
EUR 397

Macaca fascicularis Frataxin, mitochondrial (FXN)

  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 18.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Macaca fascicularis Frataxin, mitochondrial(FXN) expressed in E.coli

Frataxin (FXN) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FXN (Ser57~Leu198)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Frataxin (FXN)

Frataxin (FXN) Polyclonal Antibody (Mouse), APC-Cy7

  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FXN (Leu41~Thr207)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Frataxin (FXN). This antibody is labeled with APC-Cy7.

[KO Validated] FXN / Frataxin Rabbit pAb

A16688-100ul 100 ul
EUR 410

[KO Validated] FXN / Frataxin Rabbit pAb

A16688-200ul 200 ul
EUR 571

[KO Validated] FXN / Frataxin Rabbit pAb

A16688-20ul 20 ul
EUR 221

[KO Validated] FXN / Frataxin Rabbit pAb

A16688-50ul 50 ul
EUR 287

[KO Validated] FXN / Frataxin Polyclonal Antibody

29936-100ul 100ul
EUR 252

[KO Validated] FXN / Frataxin Polyclonal Antibody

29936-50ul 50ul
EUR 187

Frataxin (FXN) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FXN (Ser57~Leu198)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Frataxin (FXN). This antibody is labeled with APC.

Frataxin (FXN) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FXN (Ser57~Leu198)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Frataxin (FXN). This antibody is labeled with Biotin.

Frataxin (FXN) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FXN (Ser57~Leu198)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Frataxin (FXN). This antibody is labeled with Cy3.

Frataxin (FXN) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FXN (Ser57~Leu198)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Frataxin (FXN). This antibody is labeled with FITC.

Frataxin (FXN) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FXN (Ser57~Leu198)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Frataxin (FXN). This antibody is labeled with HRP.

Frataxin (FXN) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FXN (Ser57~Leu198)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Frataxin (FXN). This antibody is labeled with PE.

Rabbit Anti-Mouse Frataxin (FXN) IgG, Aff pure

FXN11-A 100 ug
EUR 482

Frataxin (FXN) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FXN (Ser57~Leu198)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Frataxin (FXN). This antibody is labeled with APC-Cy7.

Fxn/ Rat Fxn ELISA Kit

ELI-27580r 96 Tests
EUR 886


EF009718 96 Tests
EUR 689

Frataxin Protein

  • EUR 4490.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 25 ug
  • 5 ug
  • Shipped within 5-10 working days.


YF-PA11851 50 ug
EUR 363
Description: Mouse polyclonal to Frataxin


YF-PA11852 100 ul
EUR 403
Description: Rabbit polyclonal to Frataxin


YF-PA11853 100 ug
EUR 403
Description: Rabbit polyclonal to Frataxin


YF-PA23736 50 ul
EUR 334
Description: Mouse polyclonal to Frataxin

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Mouse FXN shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

FXN Recombinant Protein (Mouse)

RP135461 100 ug Ask for price


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Fxn antibody

70R-8779 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Fxn antibody

FXN Antibody

ABD6590 100 ug
EUR 438

FXN antibody

10R-6953 100 ul
EUR 691
Description: Mouse monoclonal FXN antibody

FXN antibody

10R-6954 100 ul
EUR 691
Description: Mouse monoclonal FXN antibody

FXN antibody

10R-6956 100 ul
EUR 691
Description: Mouse monoclonal FXN antibody

FXN antibody

10R-6958 100 ul
EUR 726
Description: Mouse monoclonal FXN antibody

FXN Antibody

32413-100ul 100ul
EUR 252

FXN antibody

70R-17372 50 ul
EUR 435
Description: Rabbit polyclonal FXN antibody

FXN Antibody

DF6590 200ul
EUR 304
Description: FXN Antibody detects endogenous levels of total FXN.

FXN Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against FXN. Recognizes FXN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Fxn Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Fxn. Recognizes Fxn from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000

Human Frataxin Antibody

33157-05111 150 ug
EUR 261

Recombinant Human Frataxin

7-05215 5µg Ask for price

Recombinant Human Frataxin

7-05216 20µg Ask for price

Recombinant Human Frataxin

7-05217 1mg Ask for price

Anti-Frataxin (1D9)

YF-MA13115 100 ug
EUR 363
Description: Mouse monoclonal to Frataxin

Anti-Frataxin (3F3)

YF-MA13116 100 ug
EUR 363
Description: Mouse monoclonal to Frataxin

Anti-Frataxin (3G9)

YF-MA13117 100 ug
EUR 363
Description: Mouse monoclonal to Frataxin

Anti-Frataxin (3C3)

YF-MA13118 100 ug
EUR 363
Description: Mouse monoclonal to Frataxin

Anti-Frataxin (3E7)

YF-MA13119 100 ug
EUR 363
Description: Mouse monoclonal to Frataxin

Anti-Frataxin (5D4)

YF-MA13120 100 ug
EUR 363
Description: Mouse monoclonal to Frataxin

Anti-Frataxin (5E3)

YF-MA13121 100 ug
EUR 363
Description: Mouse monoclonal to Frataxin

Fxn ORF Vector (Mouse) (pORF)

ORF045155 1.0 ug DNA
EUR 506

FXN Conjugated Antibody

C32413 100ul
EUR 397

FXN cloning plasmid

CSB-CL613687HU-10ug 10ug
EUR 287
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 633
  • Sequence: atgtggactctcgggcgccgcgcagtagccggcctcctggcgtcacccagcccggcccaggcccagaccctcacccgggtcccgcggccggcagagttggccccactctgcggccgccgtggcctgcgcaccgacatcgatgcgacctgcacgccccgccgcgcaagttcgaacca
  • Show more
Description: A cloning plasmid for the FXN gene.

anti- FXN antibody

FNab03255 100µg
EUR 585
  • Immunogen: frataxin
  • Uniprot ID: Q16595
  • Gene ID: 2395
  • Research Area: Cancer, Neuroscience, Metabolism, Signal Transduction
Description: Antibody raised against FXN

Fxn Polyclonal Antibody

A59162 100 µg
EUR 570.55
Description: fast delivery possible

FXN Rabbit pAb

A16853-100ul 100 ul
EUR 308

FXN Rabbit pAb

A16853-200ul 200 ul
EUR 459

FXN Rabbit pAb

A16853-20ul 20 ul
EUR 183

FXN Rabbit pAb

A16853-50ul 50 ul
EUR 223

Fxn Blocking Peptide

33R-9164 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Fxn antibody, catalog no. 70R-8779

FXN Blocking Peptide

DF6590-BP 1mg
EUR 195

Anti-FXN antibody

PAab03255 100 ug
EUR 412

Anti-FXN antibody

STJ23722 100 µl
EUR 277
Description: This nuclear gene encodes a mitochondrial protein which belongs to the FRATAXIN family. The protein functions in regulating mitochondrial iron transport and respiration. The expansion of intronic trinucleotide repeat GAA from 8-33 repeats to >90 repeats results in Friedreich ataxia. Alternative splicing results in multiple transcript variants.

Anti-FXN antibody

STJ113368 100 µl
EUR 277
Description: This nuclear gene encodes a mitochondrial protein which belongs to the FRATAXIN family. The protein functions in regulating mitochondrial iron transport and respiration. The expansion of intronic trinucleotide repeat GAA from 8-33 repeats to >90 repeats results in Friedreich ataxia. Alternative splicing results in multiple transcript variants.

Anti-FXN antibody

STJ119112 100 µl
EUR 413

Anti-FXN antibody

STJ119221 100 µl
EUR 277
Description: This nuclear gene encodes a mitochondrial protein which belongs to the FRATAXIN family. The protein functions in regulating mitochondrial iron transport and respiration. The expansion of intronic trinucleotide repeat GAA from 8-33 repeats to >90 repeats results in Friedreich ataxia. Alternative splicing results in multiple transcript variants.

Recombinant Mouse Frataxin, His, Yeast-100ug

QP6059-ye-100ug 100ug
EUR 571

Recombinant Mouse Frataxin, His, Yeast-10ug

QP6059-ye-10ug 10ug
EUR 272

Recombinant Mouse Frataxin, His, Yeast-1mg

QP6059-ye-1mg 1mg
EUR 2303

Recombinant Mouse Frataxin, His, Yeast-200ug

QP6059-ye-200ug 200ug
EUR 898

Recombinant Mouse Frataxin, His, Yeast-500ug

QP6059-ye-500ug 500ug
EUR 1505

Recombinant Mouse Frataxin, His, Yeast-50ug

QP6059-ye-50ug 50ug
EUR 354

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Fxn sgRNA CRISPR Lentivector set (Mouse)

K3410501 3 x 1.0 ug
EUR 339

Mouse FXN(Frataxin) ELISA Equipment