Mouse FXN(Frataxin) ELISA Kit

Mouse FXN(Frataxin) ELISA Equipment

Mouse Frataxin (FXN) ELISA Kit
4-SEC493Mu	Cloud-Clone	EUR 4913.00 EUR 2595.00 EUR 655.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Frataxin elisa. Alternative names of the recognized antigen: FA CyaY FARR FRDA X25 Friedreich ataxia protein Frataxin intermediate form Frataxin, mitochondrial
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Frataxin (FXN) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Frataxin ELISA Kit (FXN)
RK02825	Abclonal	96 Tests	EUR 521

Mouse Frataxin, mitochondrial, Fxn ELISA KIT
ELI-26735m	Lifescience Market	96 Tests	EUR 865

ELISA kit for Mouse FXN (Frataxin)
ELK7258	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Frataxin (FXN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Frataxin (FXN). Nex Show more
Description: A sandwich ELISA kit for detection of Frataxin from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Mouse Frataxin (FXN) CLIA Kit
20-abx493730	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Mouse Frataxin (FXN) Protein
20-abx167221	Abbexa	EUR 648.00 EUR 272.00 EUR 1998.00 EUR 773.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Mouse Frataxin, mitochondrial (Fxn)
1-CSB-YP009086MO	Cusabio	EUR 504.00 EUR 265.00 EUR 1832.00 EUR 763.00 EUR 1216.00 EUR 334.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 16.4 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Frataxin, mitochondrial(Fxn) expressed in Yeast

Mouse Frataxin, mitochondrial (Fxn)
1-CSB-EP009086MO	Cusabio	EUR 505.00 EUR 265.00 EUR 1827.00 EUR 766.00 EUR 1218.00 EUR 335.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 30.4 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Frataxin, mitochondrial(Fxn) expressed in E.coli

Mouse Frataxin, mitochondrial (Fxn)
1-CSB-EP009086MOa0	Cusabio	EUR 505.00 EUR 265.00 EUR 1827.00 EUR 766.00 EUR 1218.00 EUR 335.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 19.9 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Frataxin,mitochondrial(Fxn) expressed in E.coli

Human Frataxin (FXN) ELISA Kit
abx351823-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-12 working days.

Rat Frataxin (FXN) ELISA Kit
abx391355-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Frataxin(FXN)ELISA Kit
QY-E04922	Qayee Biotechnology	96T	EUR 361

Frataxin (FXN) Antibody
20-abx125858	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Frataxin (FXN) Antibody
20-abx128028	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Frataxin (FXN) Antibody
20-abx112592	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Frataxin (FXN) Antibody
20-abx129718	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Frataxin (FXN) Antibody
20-abx001453	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Frataxin (FXN) Antibody
20-abx141626	Abbexa	EUR 370.00 EUR 606.00 EUR 300.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Frataxin (FXN) Antibody
abx032827-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Frataxin (FXN) Antibody
abx032827-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Frataxin (FXN) Antibody
abx032828-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Frataxin (FXN) Antibody
abx032828-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Frataxin (FXN) Antibody
abx031313-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Frataxin (FXN) Antibody
abx031313-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Frataxin (FXN) Antibody
20-abx176502	Abbexa	EUR 1233.00 EUR 592.00	1 mg 200 ug
Please enquire.

Frataxin (FXN) Antibody
20-abx319334	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Frataxin (FXN) Antibody
abx233255-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Recombinant Frataxin (FXN)
4-RPC493Hu01	Cloud-Clone	EUR 449.44 EUR 223.00 EUR 1410.40 EUR 536.80 EUR 973.60 EUR 364.00 EUR 3376.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q16595 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 19.8kDa Isoelectric Point: 6.8
Description: Recombinant Human Frataxin expressed in: E.coli

Recombinant Frataxin (FXN)
4-RPC493Mu01	Cloud-Clone	EUR 467.36 EUR 228.00 EUR 1477.60 EUR 559.20 EUR 1018.40 EUR 376.00 EUR 3544.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: O35943 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 22.4kDa Isoelectric Point: 6.4
Description: Recombinant Mouse Frataxin expressed in: E.coli

Mouse Frataxin (FXN) control peptide
FXN11-P	Alpha Diagnostics	100 ug	EUR 164

Frataxin (FXN) Polyclonal Antibody (Mouse)
4-PAC493Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FXN (Leu41~Thr207) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Frataxin (FXN)

Rat Fxn/ Frataxin, mitochondrial ELISA Kit
E0377Ra	Sunlong	1 Kit	EUR 646

Human Frataxin, mitochondrial, FXN ELISA KIT
ELI-27579h	Lifescience Market	96 Tests	EUR 824

Bovine Frataxin, mitochondrial, FXN ELISA KIT
ELI-47324b	Lifescience Market	96 Tests	EUR 928

ELISA kit for Human FXN (Frataxin)
E-EL-H1634	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's FXN ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human FXN. Standards or samples are added to the micro ELISA plate wells and combined with the Show more
Description: A sandwich ELISA kit for quantitative measurement of Human FXN (Frataxin) in samples from Serum, Plasma, Cell supernatant

Human Frataxin (FXN) Protein
20-abx166471	Abbexa	EUR 634.00 EUR 272.00 EUR 1901.00 EUR 746.00 EUR 453.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Frataxin (FXN) Antibody (HRP)
20-abx319031	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Frataxin (FXN) Antibody (FITC)
20-abx319032	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Frataxin (FXN) Antibody (Biotin)
20-abx319033	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

FXN / Frataxin Rabbit pAb
A11785-100ul	Abclonal	100 ul	EUR 308

FXN / Frataxin Rabbit pAb
A11785-200ul	Abclonal	200 ul	EUR 459

FXN / Frataxin Rabbit pAb
A11785-20ul	Abclonal	20 ul	EUR 183

FXN / Frataxin Rabbit pAb
A11785-50ul	Abclonal	50 ul	EUR 223

FXN / Frataxin Rabbit pAb
A1745-100ul	Abclonal	100 ul	EUR 308

FXN / Frataxin Rabbit pAb
A1745-200ul	Abclonal	200 ul	EUR 459

FXN / Frataxin Rabbit pAb
A1745-20ul	Abclonal	20 ul	EUR 183

FXN / Frataxin Rabbit pAb
A1745-50ul	Abclonal	50 ul	EUR 223

FXN / Frataxin Polyclonal Antibody
27571-100ul	SAB	100ul	EUR 252

FXN / Frataxin Polyclonal Antibody
27571-50ul	SAB	50ul	EUR 187

Rat Frataxin, mitochondrial (Fxn)
1-CSB-EP009086RA	Cusabio	EUR 505.00 EUR 265.00 EUR 1827.00 EUR 766.00 EUR 1218.00 EUR 335.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 22.1 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Frataxin, mitochondrial(Fxn) expressed in E.coli

Rat Frataxin, mitochondrial (Fxn)
1-CSB-EP009086RAe1	Cusabio	EUR 621.00 EUR 381.00 EUR 1943.00 EUR 882.00 EUR 1335.00 EUR 451.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 18.6 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Frataxin, mitochondrial(Fxn) expressed in E.coli

Human Frataxin, mitochondrial (FXN)
1-CSB-EP613687HU(A4)	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 43.1 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Frataxin, mitochondrial(FXN) expressed in E.coli

Human Frataxin, mitochondrial (FxN)
1-CSB-EP613687HU(A4)b1	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 28.1 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Frataxin, mitochondrial(FxN) expressed in E.coli

Rabbit Anti-Mouse Frataxin (FXN) antiserum
FXN11-S	Alpha Diagnostics	100 ul	EUR 457

Frataxin (FXN) Polyclonal Antibody (Mouse), APC
4-PAC493Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FXN (Leu41~Thr207) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Frataxin (FXN). This antibody is labeled with APC.

Frataxin (FXN) Polyclonal Antibody (Mouse), Biotinylated
4-PAC493Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FXN (Leu41~Thr207) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Frataxin (FXN). This antibody is labeled with Biotin.

Frataxin (FXN) Polyclonal Antibody (Mouse), Cy3
4-PAC493Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FXN (Leu41~Thr207) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Frataxin (FXN). This antibody is labeled with Cy3.

Frataxin (FXN) Polyclonal Antibody (Mouse), FITC
4-PAC493Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FXN (Leu41~Thr207) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Frataxin (FXN). This antibody is labeled with FITC.

Frataxin (FXN) Polyclonal Antibody (Mouse), HRP
4-PAC493Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FXN (Leu41~Thr207) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Frataxin (FXN). This antibody is labeled with HRP.

Frataxin (FXN) Polyclonal Antibody (Mouse), PE
4-PAC493Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FXN (Leu41~Thr207) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Frataxin (FXN). This antibody is labeled with PE.

FXN / Frataxin Polyclonal Conjugated Antibody
C29936	SAB	100ul	EUR 397

FXN / Frataxin Polyclonal Conjugated Antibody
C27571	SAB	100ul	EUR 397

Macaca fascicularis Frataxin, mitochondrial (FXN)
1-CSB-EP810224MOV	Cusabio	EUR 611.00 EUR 309.00 EUR 1827.00 EUR 939.00 EUR 1218.00 EUR 397.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 18.2 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Macaca fascicularis Frataxin, mitochondrial(FXN) expressed in E.coli

Frataxin (FXN) Polyclonal Antibody (Human)
4-PAC493Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FXN (Ser57~Leu198) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Frataxin (FXN)

Frataxin (FXN) Polyclonal Antibody (Mouse), APC-Cy7
4-PAC493Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FXN (Leu41~Thr207) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Frataxin (FXN). This antibody is labeled with APC-Cy7.

[KO Validated] FXN / Frataxin Rabbit pAb
A16688-100ul	Abclonal	100 ul	EUR 410

[KO Validated] FXN / Frataxin Rabbit pAb
A16688-200ul	Abclonal	200 ul	EUR 571

[KO Validated] FXN / Frataxin Rabbit pAb
A16688-20ul	Abclonal	20 ul	EUR 221

[KO Validated] FXN / Frataxin Rabbit pAb
A16688-50ul	Abclonal	50 ul	EUR 287

[KO Validated] FXN / Frataxin Polyclonal Antibody
29936-100ul	SAB	100ul	EUR 252

[KO Validated] FXN / Frataxin Polyclonal Antibody
29936-50ul	SAB	50ul	EUR 187

Frataxin (FXN) Polyclonal Antibody (Human), APC
4-PAC493Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FXN (Ser57~Leu198) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Frataxin (FXN). This antibody is labeled with APC.

Frataxin (FXN) Polyclonal Antibody (Human), Biotinylated
4-PAC493Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FXN (Ser57~Leu198) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Frataxin (FXN). This antibody is labeled with Biotin.

Frataxin (FXN) Polyclonal Antibody (Human), Cy3
4-PAC493Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FXN (Ser57~Leu198) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Frataxin (FXN). This antibody is labeled with Cy3.

Frataxin (FXN) Polyclonal Antibody (Human), FITC
4-PAC493Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FXN (Ser57~Leu198) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Frataxin (FXN). This antibody is labeled with FITC.

Frataxin (FXN) Polyclonal Antibody (Human), HRP
4-PAC493Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FXN (Ser57~Leu198) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Frataxin (FXN). This antibody is labeled with HRP.

Frataxin (FXN) Polyclonal Antibody (Human), PE
4-PAC493Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FXN (Ser57~Leu198) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Frataxin (FXN). This antibody is labeled with PE.

Rabbit Anti-Mouse Frataxin (FXN) IgG, Aff pure
FXN11-A	Alpha Diagnostics	100 ug	EUR 482

Frataxin (FXN) Polyclonal Antibody (Human), APC-Cy7
4-PAC493Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FXN (Ser57~Leu198) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Frataxin (FXN). This antibody is labeled with APC-Cy7.

Fxn/ Rat Fxn ELISA Kit
ELI-27580r	Lifescience Market	96 Tests	EUR 886

FXN ELISA Kit (Mouse) (OKCD00331)
OKCD00331	Aviva Systems Biology	96 Wells	EUR 857
Description: Description of target: Promotes the biosynthesis of heme and assembly and repair of iron-sulfur clusters by delivering Fe2+ to proteins involved in these pathways. May play a role in the protection against iron-catalyzed oxidative stress through its ability to catalyze the oxidation of Fe2+ to Fe3+; the oligomeric form but not the monomeric form has in vitro ferroxidase activity. May be able to store large amounts of iron in the form of a ferrihydrite mineral by oligomerization. Modulates the RNA-binding activity of ACO1 (By similarity).By similarity1 Publication <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.6"Elucidation of the mechanism of mitochondrial iron loading in Friedreich's ataxia by analysis of a mouse mutant."_x005F_x005F_x000D_Huang M.L., Becker E.M., Whitnall M., Rahmanto Y.S., Ponka P., Richardson D.R._x005F_x005F_x000D_Proc. Natl. Acad. Sci. U.S.A. 106:16381-16386(2009) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION. ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.055 ng/mL

FXN ELISA KIT|Human
EF009718	Lifescience Market	96 Tests	EUR 689

FXN ELISA Kit (Human) (OKCA01248)
OKCA01248	Aviva Systems Biology	96 Wells	EUR 846
Description: Description of target: Promotes the biosynthesis of heme and assembly and repair of iron-sulfur clusters by delivering Fe2+ to proteins involved in these pathways. May play a role in the protection against iron-catalyzed oxidative stress through its ability to catalyze the oxidation of Fe2+ to Fe3+; the oligomeric form but not the monomeric form has in vitro ferroxidase activity. May be able to store large amounts of iron in the form of a ferrihydrite mineral by oligomerization; however, the physiological relevance is unsure as reports are conflicting and the function has only been shown using heterologous overexpression systems. Modulates the RNA-binding activity of ACO1.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 5.8 pg/mL

Fxn ELISA Kit (Rat) (OKEH08221)
OKEH08221	Aviva Systems Biology	96 Wells	EUR 896
Description: Description of target: ;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.028ng/mL

Frataxin Protein
20-abx262022	Abbexa	EUR 4490.00 EUR 328.00 EUR 230.00	1 mg 25 ug 5 ug
Shipped within 5-10 working days.

anti-Frataxin
YF-PA11851	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to Frataxin

anti-Frataxin
YF-PA11852	Abfrontier	100 ul	EUR 403
Description: Rabbit polyclonal to Frataxin

anti-Frataxin
YF-PA11853	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to Frataxin

anti-Frataxin
YF-PA23736	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to Frataxin

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Mouse FXN shRNA Plasmid
20-abx970395	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

FXN Recombinant Protein (Mouse)
RP135461	ABM	100 ug	Ask for price

FXN siRNA
20-abx917329	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

FXN siRNA
20-abx917330	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Fxn antibody
70R-8779	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal Fxn antibody

FXN Antibody
ABD6590	Lifescience Market	100 ug	EUR 438

FXN antibody
10R-6953	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal FXN antibody

FXN antibody
10R-6954	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal FXN antibody

FXN antibody
10R-6956	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal FXN antibody

FXN antibody
10R-6958	Fitzgerald	100 ul	EUR 726
Description: Mouse monoclonal FXN antibody

FXN Antibody
32413-100ul	SAB	100ul	EUR 252

FXN antibody
70R-17372	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal FXN antibody

FXN Antibody
DF6590	Affbiotech	200ul	EUR 304
Description: FXN Antibody detects endogenous levels of total FXN.

FXN Antibody
1-CSB-PA009086GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against FXN. Recognizes FXN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Fxn Antibody
1-CSB-PA009086LA01MO	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Fxn. Recognizes Fxn from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000

Human Frataxin Antibody
33157-05111	AssayPro	150 ug	EUR 261

Recombinant Human Frataxin
7-05215	CHI Scientific	5µg	Ask for price

Recombinant Human Frataxin
7-05216	CHI Scientific	20µg	Ask for price

Recombinant Human Frataxin
7-05217	CHI Scientific	1mg	Ask for price

Anti-Frataxin (1D9)
YF-MA13115	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to Frataxin

Anti-Frataxin (3F3)
YF-MA13116	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to Frataxin

Anti-Frataxin (3G9)
YF-MA13117	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to Frataxin

Anti-Frataxin (3C3)
YF-MA13118	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to Frataxin

Anti-Frataxin (3E7)
YF-MA13119	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to Frataxin

Anti-Frataxin (5D4)
YF-MA13120	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to Frataxin

Anti-Frataxin (5E3)
YF-MA13121	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to Frataxin

Fxn ORF Vector (Mouse) (pORF)
ORF045155	ABM	1.0 ug DNA	EUR 506

Recombinant Mouse Frataxin, His, Yeast-100ug
QP6059-ye-100ug	EnQuireBio	100ug	EUR 571

Recombinant Mouse Frataxin, His, Yeast-10ug
QP6059-ye-10ug	EnQuireBio	10ug	EUR 272

Recombinant Mouse Frataxin, His, Yeast-1mg
QP6059-ye-1mg	EnQuireBio	1mg	EUR 2303

Recombinant Mouse Frataxin, His, Yeast-200ug
QP6059-ye-200ug	EnQuireBio	200ug	EUR 898

Recombinant Mouse Frataxin, His, Yeast-500ug
QP6059-ye-500ug	EnQuireBio	500ug	EUR 1505

Recombinant Mouse Frataxin, His, Yeast-50ug
QP6059-ye-50ug	EnQuireBio	50ug	EUR 354

FXN Conjugated Antibody
C32413	SAB	100ul	EUR 397

FXN cloning plasmid
CSB-CL613687HU-10ug	Cusabio	10ug	EUR 287
Formulation: 10 μg plasmid + 200μl Glycerol Length: 633 Sequence: atgtggactctcgggcgccgcgcagtagccggcctcctggcgtcacccagcccggcccaggcccagaccctcacccgggtcccgcggccggcagagttggccccactctgcggccgccgtggcctgcgcaccgacatcgatgcgacctgcacgccccgccgcgcaagttcgaacca Show more
Description: A cloning plasmid for the FXN gene.

anti- FXN antibody
FNab03255	FN Test	100µg	EUR 585
Immunogen: frataxin Uniprot ID: Q16595 Gene ID: 2395 Research Area: Cancer, Neuroscience, Metabolism, Signal Transduction
Description: Antibody raised against FXN

Fxn Polyclonal Antibody
A59162	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

FXN Rabbit pAb
A16853-100ul	Abclonal	100 ul	EUR 308

FXN Rabbit pAb
A16853-200ul	Abclonal	200 ul	EUR 459

FXN Rabbit pAb
A16853-20ul	Abclonal	20 ul	EUR 183

FXN Rabbit pAb
A16853-50ul	Abclonal	50 ul	EUR 223

Fxn Blocking Peptide
33R-9164	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Fxn antibody, catalog no. 70R-8779

FXN Blocking Peptide
DF6590-BP	Affbiotech	1mg	EUR 195

Anti-FXN antibody
PAab03255	Lifescience Market	100 ug	EUR 412

Anti-FXN antibody
STJ23722	St John's Laboratory	100 µl	EUR 277
Description: This nuclear gene encodes a mitochondrial protein which belongs to the FRATAXIN family. The protein functions in regulating mitochondrial iron transport and respiration. The expansion of intronic trinucleotide repeat GAA from 8-33 repeats to >90 repeats results in Friedreich ataxia. Alternative splicing results in multiple transcript variants.

Anti-FXN antibody
STJ113368	St John's Laboratory	100 µl	EUR 277
Description: This nuclear gene encodes a mitochondrial protein which belongs to the FRATAXIN family. The protein functions in regulating mitochondrial iron transport and respiration. The expansion of intronic trinucleotide repeat GAA from 8-33 repeats to >90 repeats results in Friedreich ataxia. Alternative splicing results in multiple transcript variants.

Anti-FXN antibody
STJ119112	St John's Laboratory	100 µl	EUR 413

Mouse FXN(Frataxin) ELISA Equipment