Mouse CRBN(Cereblon) ELISA Equipment
Mouse Cereblon (CRBN) ELISA Kit |
RD-CRBN-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
Human Cereblon (CRBN) ELISA Kit |
DLR-CRBN-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Cereblon (CRBN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Cereblon (CRBN) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Cereblon (CRBN) ELISA Kit |
DLR-CRBN-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Cereblon (CRBN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Cereblon (CRBN) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Cereblon (CRBN) ELISA Kit |
RDR-CRBN-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Cereblon (CRBN) ELISA Kit |
RDR-CRBN-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Cereblon (CRBN) ELISA Kit |
RD-CRBN-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Cereblon (CRBN) ELISA Kit |
RD-CRBN-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Mouse Cereblon (CRBN) ELISA Kit |
20-abx153810 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Cereblon (CRBN) ELISA Kit |
SEG676Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4862.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Cereblon (CRBN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Cereblon (CRBN) in Tissue homogenates and other biological fluids. |
Mouse Cereblon (CRBN) ELISA Kit |
SEG676Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 488.08 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Cereblon (CRBN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Cereblon (CRBN) in Tissue homogenates and other biological fluids. |
Mouse Cereblon (CRBN) ELISA Kit |
SEG676Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 654.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Cereblon (CRBN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Cereblon (CRBN) in Tissue homogenates and other biological fluids. |
Mouse Cereblon (CRBN) ELISA Kit |
SEG676Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2644.8 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Cereblon (CRBN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Cereblon (CRBN) in Tissue homogenates and other biological fluids. |
Mouse Cereblon (CRBN) ELISA Kit |
4-SEG676Mu |
Cloud-Clone |
-
EUR 4913.00
-
EUR 2595.00
-
EUR 655.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Cereblon elisa. Alternative names of the recognized antigen: MRT2A
- Mental Retardation, Non-Syndromic, Autosomal Recessive 2A
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Cereblon (CRBN) in samples from Tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species. |
ELISA kit for Mouse CRBN (Cereblon) |
ELK7246 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Cereblon (CRBN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Cereblon (CRBN). N
- Show more
|
Description: A sandwich ELISA kit for detection of Cereblon from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Mouse Cereblon (CRBN) CLIA Kit |
20-abx495270 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Mouse Protein cereblon (Crbn) |
1-CSB-YP806030MO |
Cusabio |
-
EUR 504.00
-
EUR 265.00
-
EUR 1832.00
-
EUR 763.00
-
EUR 1216.00
-
EUR 334.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 54.9 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Mouse Protein cereblon(Crbn) expressed in Yeast |
Mouse Cereblon (CRBN) Protein |
20-abx652847 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Mouse Cereblon (CRBN) Protein |
20-abx652848 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Human Cereblon (CRBN)ELISA Kit |
201-12-2889 |
SunredBio |
96 tests |
EUR 440 |
- This Cereblon ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Cereblon (CRBN) ELISA Kit |
20-abx151037 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Cereblon ELISA Kit (CRBN) |
RK01182 |
Abclonal |
96 Tests |
EUR 521 |
Human Cereblon (CRBN) ELISA Kit |
SEG676Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cereblon (CRBN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cereblon (CRBN) in Tissue homogenates, cell lysates and other biological fluids. |
Human Cereblon (CRBN) ELISA Kit |
SEG676Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cereblon (CRBN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cereblon (CRBN) in Tissue homogenates, cell lysates and other biological fluids. |
Human Cereblon (CRBN) ELISA Kit |
SEG676Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cereblon (CRBN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cereblon (CRBN) in Tissue homogenates, cell lysates and other biological fluids. |
Human Cereblon (CRBN) ELISA Kit |
SEG676Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cereblon (CRBN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cereblon (CRBN) in Tissue homogenates, cell lysates and other biological fluids. |
Human Cereblon (CRBN) ELISA Kit |
4-SEG676Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Cereblon elisa. Alternative names of the recognized antigen: MRT2A
- Mental Retardation, Non-Syndromic, Autosomal Recessive 2A
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Cereblon (CRBN) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Cereblon (CRBN) Antibody |
20-abx175781 |
Abbexa |
|
|
|
Cereblon (CRBN) Antibody |
20-abx175782 |
Abbexa |
|
|
|
Cereblon (CRBN) Antibody |
20-abx175783 |
Abbexa |
|
|
|
Cereblon (CRBN) Antibody |
20-abx111556 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Cereblon (CRBN) Antibody |
20-abx171671 |
Abbexa |
|
|
|
Crbn ELISA Kit| Mouse Protein cereblon ELISA Kit |
EF014465 |
Lifescience Market |
96 Tests |
EUR 689 |
Human CRBN/ Protein cereblon ELISA Kit |
E0552Hu |
Sunlong |
1 Kit |
EUR 605 |
Human Protein cereblon (CRBN) ELISA Kit |
abx250736-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human CRBN(Protein cereblon) ELISA Kit |
EH1457 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.312-20 ng/ml
- Uniprot ID: Q96SW2
- Alias: CRBN/Protein cereblon/DKFZp781K0715/MGC27358/MRT2A/AD-006
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml |
ELISA kit for Human CRBN (Cereblon) |
ELK4870 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Cereblon (CRBN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Cereblon (CRBN). N
- Show more
|
Description: A sandwich ELISA kit for detection of Cereblon from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Cow Protein cereblon (CRBN) ELISA Kit |
abx516195-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Chicken Protein cereblon (CRBN) ELISA Kit |
abx516196-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Rat Protein cereblon (CRBN) ELISA Kit |
abx516199-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Human Cereblon (CRBN) CLIA Kit |
20-abx495269 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Protein Cereblon (CRBN) Antibody |
20-abx003568 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Protein Cereblon (CRBN) Antibody |
abx200563-50ug |
Abbexa |
50 ug |
EUR 453 |
- Shipped within 3-5 working days.
|
Protein Cereblon (CRBN) Antibody |
20-abx322665 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Protein Cereblon (CRBN) Antibody |
20-abx322666 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Human Cereblon (CRBN) Protein |
20-abx652846 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Protein Cereblon (CRBN) Antibody |
abx231954-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Human Protein cereblon (CRBN) |
1-CSB-BP842761HU |
Cusabio |
-
EUR 761.00
-
EUR 306.00
-
EUR 1951.00
-
EUR 1026.00
-
EUR 1422.00
-
EUR 431.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 50.4 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Protein cereblon(CRBN) expressed in Baculovirus |
Human Protein cereblon (CRBN) |
1-CSB-CF842761HU |
Cusabio |
-
EUR 965.00
-
EUR 665.00
-
EUR 715.00
|
|
- MW: 54.5 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Protein cereblon(CRBN) expressed in in vitro E.coli expression system |
Human Protein cereblon (CRBN) |
1-CSB-CF842761HUa6 |
Cusabio |
-
EUR 965.00
-
EUR 665.00
-
EUR 715.00
|
|
- MW: 64.5 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Protein cereblon(CRBN) expressed in in vitro E.coli expression system |
Human Protein cereblon (CRBN) |
1-CSB-CF842761HUc7 |
Cusabio |
-
EUR 965.00
-
EUR 665.00
-
EUR 715.00
|
|
- MW: 51.2 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Protein cereblon(CRBN) expressed in in vitro E.coli expression system |
Crbn ELISA Kit| Rat Protein cereblon ELISA Kit |
EF018463 |
Lifescience Market |
96 Tests |
EUR 689 |
CRBN ELISA Kit| Bovine Protein cereblon ELISA Kit |
EF011221 |
Lifescience Market |
96 Tests |
EUR 689 |
CRBN ELISA Kit| chicken Protein cereblon ELISA Kit |
EF012243 |
Lifescience Market |
96 Tests |
EUR 689 |
Rabbit Polyclonal antibody Anti-CRBN |
Anti-CRBN |
ImmunoStep |
50 µg |
EUR 349 |
Polyclonal CRBN / Cereblon Antibody (C-Terminus) |
APR11660G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CRBN / Cereblon (C-Terminus). This antibody is tested and proven to work in the following applications: |
ELISA kit for Human Protein cereblon |
EK3125 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Protein cereblon in samples from serum, plasma, tissue homogenates and other biological fluids. |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Mouse CRBN shRNA Plasmid |
20-abx975104 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
CRBN antibody |
70R-16578 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal CRBN antibody |
CRBN antibody |
70R-3211 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal CRBN antibody raised against the N terminal of CRBN |
CRBN Antibody |
1-CSB-PA842761ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against CRBN. Recognizes CRBN from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
CRBN Antibody |
1-CSB-PA842761ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against CRBN. Recognizes CRBN from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
CRBN Antibody |
1-CSB-PA005944GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against CRBN. Recognizes CRBN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
CRBN Antibody |
DF12054 |
Affbiotech |
200ul |
EUR 304 |
Description: CRBN antibody detects endogenous levels of CRBN. |
CRBN siRNA |
20-abx901245 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CRBN siRNA |
20-abx912756 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CRBN siRNA |
20-abx912757 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-CRBN |
YF-PA18916 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to CRBN |
Crbn ORF Vector (Mouse) (pORF) |
ORF041971 |
ABM |
1.0 ug DNA |
EUR 506 |
Crbn ORF Vector (Mouse) (pORF) |
ORF041972 |
ABM |
1.0 ug DNA |
EUR 506 |
CRBN Polyclonal Antibody |
30601-100ul |
SAB |
100ul |
EUR 252 |
CRBN Polyclonal Antibody |
30601-50ul |
SAB |
50ul |
EUR 187 |
CRBN Blocking Peptide |
33R-2125 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CRBN antibody, catalog no. 70R-3211 |
CRBN Blocking Peptide |
DF12054-BP |
Affbiotech |
1mg |
EUR 195 |
Polyclonal CRBN Antibody |
APR11661G |
Leading Biology |
0.1 mg |
EUR 659 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CRBN . This antibody is tested and proven to work in the following applications: |
CRBN cloning plasmid |
CSB-CL842761HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1329
- Sequence: atggccggcgaaggagatcagcaggacgctgcgcacaacatgggcaaccacctgccgctcctgcctgcagagagtgaggaagaagatgaaatggaagttgaagaccaggatagtaaagaagccaaaaaaccaaacatcataaattttgacaccagtctgccgacatcacatacat
- Show more
|
Description: A cloning plasmid for the CRBN gene. |
CRBN cloning plasmid |
CSB-CL842761HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1326
- Sequence: atggccggcgaaggagatcagcaggacgctgcgcacaacatgggcaaccacctgccgctcctgcctgagagtgaggaagaagatgaaatggaagttgaagaccaggatagtaaagaagccaaaaaaccaaacatcataaattttgacaccagtctgccgacatcacatacatacc
- Show more
|
Description: A cloning plasmid for the CRBN gene. |
CRBN Rabbit pAb |
A4722-100ul |
Abclonal |
100 ul |
EUR 308 |
CRBN Rabbit pAb |
A4722-200ul |
Abclonal |
200 ul |
EUR 459 |
CRBN Rabbit pAb |
A4722-20ul |
Abclonal |
20 ul |
EUR 183 |
CRBN Rabbit pAb |
A4722-50ul |
Abclonal |
50 ul |
EUR 223 |
anti- CRBN antibody |
FNab01954 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:500-1:2000
- IHC: 1:50-1:200
- Immunogen: cereblon
- Uniprot ID: Q96SW2
- Gene ID: 51185
- Research Area: Metabolism
|
Description: Antibody raised against CRBN |
Anti-CRBN antibody |
STJ26824 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a protein related to the Lon protease protein family. In rodents and other mammals this gene product is found in the cytoplasm localized with a calcium channel membrane protein, and is thought to play a role in brain development. Mutations in this gene are associated with autosomal recessive nonsyndromic mental retardation. Multiple transcript variants encoding different isoforms have been found for this gene. |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
Crbn sgRNA CRISPR Lentivector set (Mouse) |
K3487501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
Rat CRBN shRNA Plasmid |
20-abx988863 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
CRBN Polyclonal Conjugated Antibody |
C30601 |
SAB |
100ul |
EUR 397 |
Human CRBN shRNA Plasmid |
20-abx959590 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Homo-PROTAC cereblon degrader 1 |
HY-111594 |
MedChemExpress |
10mg |
EUR 1772 |
Crbn sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3487502 |
ABM |
1.0 ug DNA |
EUR 154 |
Crbn sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3487503 |
ABM |
1.0 ug DNA |
EUR 154 |
Crbn sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3487504 |
ABM |
1.0 ug DNA |
EUR 154 |
CRBN Protein Vector (Mouse) (pPB-C-His) |
PV167882 |
ABM |
500 ng |
EUR 603 |
CRBN Protein Vector (Mouse) (pPB-N-His) |
PV167883 |
ABM |
500 ng |
EUR 603 |
CRBN Protein Vector (Mouse) (pPM-C-HA) |
PV167884 |
ABM |
500 ng |
EUR 603 |
CRBN Protein Vector (Mouse) (pPM-C-His) |
PV167885 |
ABM |
500 ng |
EUR 603 |
CRBN Protein Vector (Mouse) (pPB-C-His) |
PV167886 |
ABM |
500 ng |
EUR 603 |
CRBN Protein Vector (Mouse) (pPB-N-His) |
PV167887 |
ABM |
500 ng |
EUR 603 |
CRBN Protein Vector (Mouse) (pPM-C-HA) |
PV167888 |
ABM |
500 ng |
EUR 603 |
CRBN Protein Vector (Mouse) (pPM-C-His) |
PV167889 |
ABM |
500 ng |
EUR 603 |
Recombinant Mouse Protein cereblon Protein, His, Yeast-100ug |
QP9830-ye-100ug |
EnQuireBio |
100ug |
EUR 571 |
Recombinant Mouse Protein cereblon Protein, His, Yeast-10ug |
QP9830-ye-10ug |
EnQuireBio |
10ug |
EUR 272 |
Recombinant Mouse Protein cereblon Protein, His, Yeast-1mg |
QP9830-ye-1mg |
EnQuireBio |
1mg |
EUR 2303 |
Recombinant Mouse Protein cereblon Protein, His, Yeast-200ug |
QP9830-ye-200ug |
EnQuireBio |
200ug |
EUR 898 |
Recombinant Mouse Protein cereblon Protein, His, Yeast-500ug |
QP9830-ye-500ug |
EnQuireBio |
500ug |
EUR 1505 |
Recombinant Mouse Protein cereblon Protein, His, Yeast-50ug |
QP9830-ye-50ug |
EnQuireBio |
50ug |
EUR 354 |
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV100PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV105PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV120PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV125PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS700A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS720A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS740A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Mouse CRBN(Cereblon) ELISA Equipment