Human RPL13A(Ribosomal Protein L13A) ELISA Kit

Human RPL13A(Ribosomal Protein L13A) ELISA Equipment

Human Ribosomal Protein L13A (RPL13A) ELISA Kit

RDR-RPL13A-Hu-96Tests 96 Tests
EUR 820

Human Ribosomal Protein L13A (RPL13A) ELISA Kit

RD-RPL13A-Hu-48Tests 48 Tests
EUR 563

Human Ribosomal Protein L13A (RPL13A) ELISA Kit

RD-RPL13A-Hu-96Tests 96 Tests
EUR 783

Human Ribosomal Protein L13A (RPL13A) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Ribosomal Protein L13A (RPL13A) ELISA Kit

SEQ321Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribosomal Protein L13A (RPL13A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribosomal Protein L13A (RPL13A) in Tissue homogenates and other biological fluids.

Human Ribosomal Protein L13A (RPL13A) ELISA Kit

SEQ321Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribosomal Protein L13A (RPL13A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribosomal Protein L13A (RPL13A) in Tissue homogenates and other biological fluids.

Human Ribosomal Protein L13A (RPL13A) ELISA Kit

SEQ321Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribosomal Protein L13A (RPL13A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribosomal Protein L13A (RPL13A) in Tissue homogenates and other biological fluids.

Human Ribosomal Protein L13A (RPL13A) ELISA Kit

SEQ321Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribosomal Protein L13A (RPL13A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribosomal Protein L13A (RPL13A) in Tissue homogenates and other biological fluids.

Human Ribosomal Protein L13A (RPL13A) ELISA Kit

  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Ribosomal Protein L13A elisa. Alternative names of the recognized antigen: TSTA1
  • Tissue Specific Transplantation Antigen 1
  • 60S ribosomal protein L13a
  • 23 kDa highly basic protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Ribosomal Protein L13A (RPL13A) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Ribosomal Protein L13A (RPL13A) Antibody

abx218352-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Ribosomal Protein L13A (RPL13A) Antibody

  • EUR 1316.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Ribosomal Protein L13A (RPL13A) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ribosomal Protein L13A (RPL13A) Antibody

  • EUR 926.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Ribosomal Protein L13A (RPL13A) Antibody

abx237413-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Ribosomal Protein L13A (RPL13A) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human Ribosomal Protein L13A (RPL13A) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human Ribosomal Protein L13A (RPL13A) CLIA Kit

  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human 60S ribosomal protein L13a(RPL13A) ELISA kit

E01R0435-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human 60S ribosomal protein L13a(RPL13A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human 60S ribosomal protein L13a(RPL13A) ELISA kit

E01R0435-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human 60S ribosomal protein L13a(RPL13A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human 60S ribosomal protein L13a(RPL13A) ELISA kit

E01R0435-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human 60S ribosomal protein L13a(RPL13A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human RPL13A (Ribosomal Protein L13A)

ELK6967 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Ribosomal Protein L13A (RPL13A). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Ri
  • Show more
Description: A sandwich ELISA kit for detection of Ribosomal Protein L13A from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human 60S ribosomal protein L13a, RPL13A ELISA KIT

ELI-35765h 96 Tests
EUR 824

Ribosomal Protein L13A (RPL13A) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ribosomal Protein L13A (RPL13A) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ribosomal Protein L13A (RPL13A) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rabbit 60S ribosomal protein L13a(RPL13A) ELISA kit

E04R0435-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 60S ribosomal protein L13a(RPL13A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit 60S ribosomal protein L13a(RPL13A) ELISA kit

E04R0435-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 60S ribosomal protein L13a(RPL13A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit 60S ribosomal protein L13a(RPL13A) ELISA kit

E04R0435-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 60S ribosomal protein L13a(RPL13A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 60S ribosomal protein L13a(RPL13A) ELISA kit

E02R0435-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat 60S ribosomal protein L13a(RPL13A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 60S ribosomal protein L13a(RPL13A) ELISA kit

E02R0435-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat 60S ribosomal protein L13a(RPL13A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 60S ribosomal protein L13a(RPL13A) ELISA kit

E02R0435-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat 60S ribosomal protein L13a(RPL13A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 60S ribosomal protein L13a(RPL13A) ELISA kit

E03R0435-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse 60S ribosomal protein L13a(RPL13A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 60S ribosomal protein L13a(RPL13A) ELISA kit

E03R0435-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse 60S ribosomal protein L13a(RPL13A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 60S ribosomal protein L13a(RPL13A) ELISA kit

E03R0435-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse 60S ribosomal protein L13a(RPL13A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat 60S ribosomal protein L13a(RPL13A) ELISA kit

E06R0435-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat 60S ribosomal protein L13a(RPL13A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat 60S ribosomal protein L13a(RPL13A) ELISA kit

E06R0435-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat 60S ribosomal protein L13a(RPL13A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat 60S ribosomal protein L13a(RPL13A) ELISA kit

E06R0435-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat 60S ribosomal protein L13a(RPL13A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog 60S ribosomal protein L13a(RPL13A) ELISA kit

E08R0435-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine 60S ribosomal protein L13a(RPL13A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog 60S ribosomal protein L13a(RPL13A) ELISA kit

E08R0435-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine 60S ribosomal protein L13a(RPL13A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog 60S ribosomal protein L13a(RPL13A) ELISA kit

E08R0435-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine 60S ribosomal protein L13a(RPL13A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig 60S ribosomal protein L13a(RPL13A) ELISA kit

E07R0435-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine 60S ribosomal protein L13a(RPL13A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig 60S ribosomal protein L13a(RPL13A) ELISA kit

E07R0435-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine 60S ribosomal protein L13a(RPL13A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig 60S ribosomal protein L13a(RPL13A) ELISA kit

E07R0435-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine 60S ribosomal protein L13a(RPL13A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey 60S ribosomal protein L13a(RPL13A) ELISA kit

E09R0435-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey 60S ribosomal protein L13a(RPL13A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey 60S ribosomal protein L13a(RPL13A) ELISA kit

E09R0435-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey 60S ribosomal protein L13a(RPL13A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey 60S ribosomal protein L13a(RPL13A) ELISA kit

E09R0435-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey 60S ribosomal protein L13a(RPL13A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Bovine 60S ribosomal protein L13a, RPL13A ELISA KIT

ELI-18458b 96 Tests
EUR 928

Mouse 60S ribosomal protein L13a, Rpl13a ELISA KIT

ELI-52556m 96 Tests
EUR 865

Porcine 60S ribosomal protein L13a, RPL13A ELISA KIT

ELI-41125p 96 Tests
EUR 928

Guinea pig 60S ribosomal protein L13a(RPL13A) ELISA kit

E05R0435-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig 60S ribosomal protein L13a(RPL13A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig 60S ribosomal protein L13a(RPL13A) ELISA kit

E05R0435-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig 60S ribosomal protein L13a(RPL13A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig 60S ribosomal protein L13a(RPL13A) ELISA kit

E05R0435-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig 60S ribosomal protein L13a(RPL13A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rpl13a/ Rat Rpl13a ELISA Kit

ELI-38895r 96 Tests
EUR 886


EF002570 96 Tests
EUR 689


ELI-30293d 96 Tests
EUR 928

RPL13A Recombinant Protein (Human)

RP026839 100 ug Ask for price

RPL13A Recombinant Protein (Human)

RP026842 100 ug Ask for price

RPL13A Recombinant Protein (Human)

RP026845 100 ug Ask for price

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

RPL13A antibody

22135-100ul 100ul
EUR 390

RPL13A antibody

70R-12658 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal RPL13A antibody

RPL13A antibody

70R-19965 50 ul
EUR 435
Description: Rabbit polyclonal RPL13A antibody

RPL13A antibody

70R-3024 50 ug
EUR 467
Description: Rabbit polyclonal RPL13A antibody raised against the middle region of RPL13A

RPL13A Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL13A. Recognizes RPL13A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

RPL13A Antibody

DF9126 200ul
EUR 304
Description: RPL13A Antibody detects endogenous levels of total RPL13A.

RPL13A Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RPL13A. Recognizes RPL13A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPL13A Antibody

ABD9126 100 ug
EUR 438


PVT18297 2 ug
EUR 231

RPL13A Recombinant Protein (Mouse)

RP168968 100 ug Ask for price

RPL13A Recombinant Protein (Rat)

RP226607 100 ug Ask for price

Human RPL13A shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

Human Ribosomal Protein L10 ELISA kit

E01R0072-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Ribosomal Protein L10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ribosomal Protein L10 ELISA kit

E01R0072-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Ribosomal Protein L10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ribosomal Protein L10 ELISA kit

E01R0072-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Ribosomal Protein L10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ribosomal Protein L26 ELISA kit

E01R0075-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Ribosomal Protein L26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ribosomal Protein L26 ELISA kit

E01R0075-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Ribosomal Protein L26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ribosomal Protein L26 ELISA kit

E01R0075-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Ribosomal Protein L26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ribosomal Protein S19 ELISA kit

E01R0076-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Ribosomal Protein S19 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ribosomal Protein S19 ELISA kit

E01R0076-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Ribosomal Protein S19 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ribosomal Protein S19 ELISA kit

E01R0076-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Ribosomal Protein S19 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ribosomal protein L4 ELISA KIT|Human

EF002461 96 Tests
EUR 689

RPL13A Blocking Peptide

33R-3724 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RPL13A antibody, catalog no. 70R-3024

RPL13A Blocking Peptide

DF9126-BP 1mg
EUR 195

Anti-RPL13A Antibody

A03571-1 100ug/vial
EUR 334

Mouse Rpl13a Antibody

abx030929-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Mouse Rpl13a Antibody

abx030929-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

RPL13A cloning plasmid

CSB-CL020130HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 612
  • Sequence: atggcggaggtgcaggtcctggtgcttgatggtcgaggccatctcctgggccgcctggcggccatcgtggctaaacaggtactgctgggccggaaggtggtggtcgtacgctgtgaaggcatcaacatttctggcaatttctacagaaacaagttgaagtacctggctttcctccg
  • Show more
Description: A cloning plasmid for the RPL13A gene.

RPL13A cloning plasmid

CSB-CL020130HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 612
  • Sequence: atggcggaggtgcaggtcctggtgcttgatggtcgaggccatctcctgggccgcctggcggccatcgtggctaaacaggtactgctgggccggaaggtggtggtcgtacgctgtgaaggcatcaacatttctggcaatttctacagaaacaagttgaagtacctggctttcctccg
  • Show more
Description: A cloning plasmid for the RPL13A gene.

RPL13A cloning plasmid

CSB-CL020130HU3-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 612
  • Sequence: atggcggaggtgcaggtcctggtgcttgatggtcgaggccatctcctgggccgcctggcggccatcgtggctaaacaggtactgctgggccggaaggtggtggtcgtacgctgtgaaggcatcaacatttctggcaatttctacagaaacaagttgaagtacctggctttcctccg
  • Show more
Description: A cloning plasmid for the RPL13A gene.

anti- RPL13A antibody

FNab07413 100µg
EUR 548.75
  • Immunogen: ribosomal protein L13a
  • Uniprot ID: P40429
  • Gene ID: 23521
  • Research Area: Metabolism
Description: Antibody raised against RPL13A

Anti-RPL13A antibody

PAab07413 100 ug
EUR 386

pENTR223-RPL13A vector

PVT11967 2 ug
EUR 308

RPL13A ORF Vector (Human) (pORF)

ORF008947 1.0 ug DNA
EUR 95

RPL13A ORF Vector (Human) (pORF)

ORF008948 1.0 ug DNA
EUR 95

RPL13A ORF Vector (Human) (pORF)

ORF008949 1.0 ug DNA
EUR 95

RPL13A Protein Vector (Human) (pPB-C-His)

PV035785 500 ng
EUR 329

RPL13A Protein Vector (Human) (pPB-N-His)

PV035786 500 ng
EUR 329

RPL13A Protein Vector (Human) (pPM-C-HA)

PV035787 500 ng
EUR 329

RPL13A Protein Vector (Human) (pPM-C-His)

PV035788 500 ng
EUR 329

RPL13A Protein Vector (Human) (pPB-C-His)

PV035789 500 ng
EUR 329

RPL13A Protein Vector (Human) (pPB-N-His)

PV035790 500 ng
EUR 329

RPL13A Protein Vector (Human) (pPM-C-HA)

PV035791 500 ng
EUR 329

RPL13A Protein Vector (Human) (pPM-C-His)

PV035792 500 ng
EUR 329

RPL13A Protein Vector (Human) (pPB-C-His)

PV035793 500 ng
EUR 329

RPL13A Protein Vector (Human) (pPB-N-His)

PV035794 500 ng
EUR 329

RPL13A Protein Vector (Human) (pPM-C-HA)

PV035795 500 ng
EUR 329

RPL13A Protein Vector (Human) (pPM-C-His)

PV035796 500 ng
EUR 329

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Human Ribosomal Protein L23A (RPL23A) ELISA Kit

DLR-RPL23A-Hu-48T 48T
EUR 554
  • Should the Human Ribosomal Protein L23A (RPL23A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ribosomal Protein L23A (RPL23A) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Ribosomal Protein L23A (RPL23A) ELISA Kit

DLR-RPL23A-Hu-96T 96T
EUR 725
  • Should the Human Ribosomal Protein L23A (RPL23A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ribosomal Protein L23A (RPL23A) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Ribosomal Protein L6 (RPL6) ELISA Kit

DLR-RPL6-Hu-48T 48T
EUR 517
  • Should the Human Ribosomal Protein L6 (RPL6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ribosomal Protein L6 (RPL6) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Ribosomal Protein L6 (RPL6) ELISA Kit

DLR-RPL6-Hu-96T 96T
EUR 673
  • Should the Human Ribosomal Protein L6 (RPL6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ribosomal Protein L6 (RPL6) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Mitochondrial Ribosomal Protein L17 ELISA kit

E01M0227-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Mitochondrial Ribosomal Protein L17 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mitochondrial Ribosomal Protein L17 ELISA kit

E01M0227-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Mitochondrial Ribosomal Protein L17 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mitochondrial Ribosomal Protein L17 ELISA kit

E01M0227-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Mitochondrial Ribosomal Protein L17 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ribosomal Protein L6 (RPL6) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Ribosomal Protein S9 (RPS9) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Ribosomal Protein L4 (RPL4) ELISA Kit

abx259815-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein L13 (RPL13) ELISA Kit

abx251672-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human RPS19(Ribosomal protein S19) ELISA Kit

EH11973 96T
EUR 524.1
  • Detection range: 31.25-2000 pg/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

Human Ribosomal Protein L26 (RPL26) ELISA Kit

abx351725-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Ribosomal Protein L10 (RPL10) ELISA Kit

abx382895-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Ribosomal Protein L10A (RPL10A) ELISA Kit

abx382896-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein L11 (RPL11) ELISA Kit

abx382897-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein L12 (RPL12) ELISA Kit

abx382898-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein L14 (RPL14) ELISA Kit

abx382900-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein L15 (RPL15) ELISA Kit

abx382901-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein L17 (RPL17) ELISA Kit

abx382902-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein L18A (RPL18A) ELISA Kit

abx382903-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein L19 (RPL19) ELISA Kit

abx382904-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein L21 (RPL21) ELISA Kit

abx382905-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein L22 (RPL22) ELISA Kit

abx382906-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein L23 (RPL23) ELISA Kit

abx382907-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein L24 (RPL24) ELISA Kit

abx382909-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein L27 (RPL27) ELISA Kit

abx382911-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein L27A (RPL27A) ELISA Kit

abx382912-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein L28 (RPL28) ELISA Kit

abx382913-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein L3 (RPL3) ELISA Kit

abx382914-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein L30 (RPL30) ELISA Kit

abx382915-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein L31 (RPL31) ELISA Kit

abx382916-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein L32 (RPL32) ELISA Kit

abx382917-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein L35 (RPL35) ELISA Kit

abx382918-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein L37a (RPL37A) ELISA Kit

abx382920-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein L38 (RPL38) ELISA Kit

abx382921-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein L39 (RPL39) ELISA Kit

abx382922-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein L5 (RPL5) ELISA Kit

abx382924-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein L7 (RPL7) ELISA Kit

abx382926-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein L7a (RPL7A) ELISA Kit

abx382927-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein L8 (RPL8) ELISA Kit

abx382929-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein L9 (RPL9) ELISA Kit

abx382930-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein S10 (RPS10) ELISA Kit

abx382940-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein S12 (RPS12) ELISA Kit

abx382941-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein S16 (RPS16) ELISA Kit

abx382944-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein S19 (RPS19) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Human Ribosomal Protein S20 (RPS20) ELISA Kit

abx382946-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein S21 (RPS21) ELISA Kit

abx382947-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein S24 (RPS24) ELISA Kit

abx382948-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein S26 (RPS26) ELISA Kit

abx382950-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein S27 (RPS27) ELISA Kit

abx382951-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein S28 (RPS28) ELISA Kit

abx382953-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein S29 (RPS29) ELISA Kit

abx382954-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein S3 (RPS3) ELISA Kit

abx382955-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein S3A (RPS3A) ELISA Kit

abx382956-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein S5 (RPS5) ELISA Kit

abx382959-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein S6 (RPS6) ELISA Kit

abx382960-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein S7 (RPS7) ELISA Kit

abx382962-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein S8 (RPS8) ELISA Kit

abx382963-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosomal Protein S13 (RPS13) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Human Ribosomal Protein S25 (RPS25) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Human Ribosomal Protein S15 (RPS15) ELISA Kit

abx520475-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Ribosomal Protein L6(RPL6)ELISA Kit

QY-E03156 96T
EUR 361

Human Ribosomal Protein L23A(RPL23A)ELISA Kit

QY-E03157 96T
EUR 361

Human Ribosomal Protein S9 (RPS9) ELISA Kit

SEF039Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribosomal Protein S9 (RPS9) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribosomal Protein S9 (RPS9) in Tissue homogenates, cell lysates and other biological fluids.

Human Ribosomal Protein S9 (RPS9) ELISA Kit

SEF039Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribosomal Protein S9 (RPS9) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribosomal Protein S9 (RPS9) in Tissue homogenates, cell lysates and other biological fluids.

Human Ribosomal Protein S9 (RPS9) ELISA Kit

SEF039Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribosomal Protein S9 (RPS9) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribosomal Protein S9 (RPS9) in Tissue homogenates, cell lysates and other biological fluids.

Human Ribosomal Protein S9 (RPS9) ELISA Kit

SEF039Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribosomal Protein S9 (RPS9) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribosomal Protein S9 (RPS9) in Tissue homogenates, cell lysates and other biological fluids.

Human Ribosomal Protein S9 (RPS9) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Ribosomal Protein S9 elisa. Alternative names of the recognized antigen: 40S Ribosomal Protein S9
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Ribosomal Protein S9 (RPS9) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Ribosomal Protein L6 (RPL6) ELISA Kit

SEF046Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribosomal Protein L6 (RPL6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribosomal Protein L6 (RPL6) in tissue homogenates, cell lysates and other biological fluids.

Human Ribosomal Protein L6 (RPL6) ELISA Kit

SEF046Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribosomal Protein L6 (RPL6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribosomal Protein L6 (RPL6) in tissue homogenates, cell lysates and other biological fluids.

Human Ribosomal Protein L6 (RPL6) ELISA Kit

SEF046Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribosomal Protein L6 (RPL6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribosomal Protein L6 (RPL6) in tissue homogenates, cell lysates and other biological fluids.

Human Ribosomal Protein L6 (RPL6) ELISA Kit

SEF046Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribosomal Protein L6 (RPL6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribosomal Protein L6 (RPL6) in tissue homogenates, cell lysates and other biological fluids.

Human Ribosomal Protein L6 (RPL6) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Ribosomal Protein L6 elisa. Alternative names of the recognized antigen: SHUJUN-2
  • TAXREB107
  • TXREB1
  • Neoplasm-related protein C140
  • Tax-responsive enhancer element-binding protein 107
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Ribosomal Protein L6 (RPL6) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Ribosomal Protein L23A (RPL23A) ELISA Kit

RDR-RPL23A-Hu-48Tests 48 Tests
EUR 589

Human Ribosomal Protein L23A (RPL23A) ELISA Kit

RDR-RPL23A-Hu-96Tests 96 Tests
EUR 820

Human Ribosomal Protein L6 (RPL6) ELISA Kit

RDR-RPL6-Hu-48Tests 48 Tests
EUR 544

Human Ribosomal Protein L6 (RPL6) ELISA Kit

RDR-RPL6-Hu-96Tests 96 Tests
EUR 756

Human Ribosomal Protein L23A (RPL23A) ELISA Kit

RD-RPL23A-Hu-48Tests 48 Tests
EUR 563

Human Ribosomal Protein L23A (RPL23A) ELISA Kit

RD-RPL23A-Hu-96Tests 96 Tests
EUR 783

Human Ribosomal Protein L6 (RPL6) ELISA Kit

RD-RPL6-Hu-48Tests 48 Tests
EUR 521

Human Ribosomal Protein L6 (RPL6) ELISA Kit

RD-RPL6-Hu-96Tests 96 Tests
EUR 723

RPL13A Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL13A. Recognizes RPL13A from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RPL13A Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL13A. Recognizes RPL13A from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RPL13A Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL13A. Recognizes RPL13A from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Mouse RPL13A shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RPL13A sgRNA CRISPR Lentivector set (Human)

K1905801 3 x 1.0 ug
EUR 339

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Human RPL13A(Ribosomal Protein L13A) ELISA Equipment