Human ROMO1(Reactive Oxygen Species Modulator 1) ELISA Kit

Human ROMO1(Reactive Oxygen Species Modulator 1) ELISA Package

Human Reactive Oxygen Species Modulator 1 (ROMO1) ELISA Kit

RDR-ROMO1-Hu-48Tests 48 Tests
EUR 589

Human Reactive Oxygen Species Modulator 1 (ROMO1) ELISA Kit

RDR-ROMO1-Hu-96Tests 96 Tests
EUR 820

Mouse Reactive Oxygen Species Modulator 1 (ROMO1) ELISA Kit

DLR-ROMO1-Mu-48T 48T
EUR 566
  • Should the Mouse Reactive Oxygen Species Modulator 1 (ROMO1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Reactive Oxygen Species Modulator 1 (ROMO1) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Reactive Oxygen Species Modulator 1 (ROMO1) ELISA Kit

DLR-ROMO1-Mu-96T 96T
EUR 741
  • Should the Mouse Reactive Oxygen Species Modulator 1 (ROMO1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Reactive Oxygen Species Modulator 1 (ROMO1) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Reactive Oxygen Species Modulator 1 (ROMO1) ELISA Kit

RD-ROMO1-Mu-48Tests 48 Tests
EUR 577

Mouse Reactive Oxygen Species Modulator 1 (ROMO1) ELISA Kit

RD-ROMO1-Mu-96Tests 96 Tests
EUR 802

Mouse Reactive Oxygen Species Modulator 1 (ROMO1) ELISA Kit

RDR-ROMO1-Mu-48Tests 48 Tests
EUR 603

Mouse Reactive Oxygen Species Modulator 1 (ROMO1) ELISA Kit

RDR-ROMO1-Mu-96Tests 96 Tests
EUR 840

Reactive Oxygen Species Modulator 1 (ROMO1) Antibody

  • EUR 926.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Reactive Oxygen Species Modulator 1 (ROMO1) Antibody

  • EUR 1316.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Reactive Oxygen Species Modulator 1 (ROMO1) Antibody

abx237383-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Reactive Oxygen Species Modulator 1 (ROMO1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mouse Reactive oxygen species modulator 1 (Romo1)

  • EUR 1163.00
  • EUR 437.00
  • EUR 693.00
  • 1MG
  • 200ug
  • 500ug
  • MW: 11.0 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Reactive oxygen species modulator 1(Romo1) expressed in in vitro E.coli expression system

Human Reactive oxygen species modulator 1 (ROMO1) ELISA Kit

abx571602-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human ROMO1/ Reactive oxygen species modulator 1 ELISA Kit

E2168Hu 1 Kit
EUR 571

Human ROMO1(Reactive oxygen species modulator 1) ELISA Kit

EH2003 96T
EUR 567.6
  • Detection range: 31.2-2000 pg/ml
  • Uniprot ID: P60602
  • Alias: ROMO1/Reactive oxygen species modulator 1/ROS modulator 1/Protein MGR2 homolog/Mitochondrial targeting GxxxG motif protein/MTGM/Protein MGR2 homolog/Glyrichin
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

Human Reactive oxygen species modulator 1, ROMO1 ELISA KIT

ELI-06179h 96 Tests
EUR 824

Human Reactive Oxygen Species Modulator 1 (ROMO1) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Reactive oxygen species modulator 1 (ROMO1) ELISA Kit

abx251327-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Reactive Oxygen Species Modulator 1 (ROMO1) ELISA Kit

SEQ510Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reactive Oxygen Species Modulator 1 (ROMO1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reactive Oxygen Species Modulator 1 (ROMO1) in Tissue homogenates, cell lysates and other biological fluids.

Human Reactive Oxygen Species Modulator 1 (ROMO1) ELISA Kit

SEQ510Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reactive Oxygen Species Modulator 1 (ROMO1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reactive Oxygen Species Modulator 1 (ROMO1) in Tissue homogenates, cell lysates and other biological fluids.

Human Reactive Oxygen Species Modulator 1 (ROMO1) ELISA Kit

SEQ510Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reactive Oxygen Species Modulator 1 (ROMO1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reactive Oxygen Species Modulator 1 (ROMO1) in Tissue homogenates, cell lysates and other biological fluids.

Human Reactive Oxygen Species Modulator 1 (ROMO1) ELISA Kit

SEQ510Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reactive Oxygen Species Modulator 1 (ROMO1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reactive Oxygen Species Modulator 1 (ROMO1) in Tissue homogenates, cell lysates and other biological fluids.

Human Reactive Oxygen Species Modulator 1 (ROMO1) ELISA Kit

  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Reactive Oxygen Species Modulator 1 elisa. Alternative names of the recognized antigen: C20orf52
  • Glyrichin
  • Mitochondrial Targeting GXXXG Protein
  • Epididymis tissue protein Li 175
  • Protein MGR2 homolog
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Reactive Oxygen Species Modulator 1 (ROMO1) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Reactive Oxygen Species Modulator 1 (ROMO1) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Cow Reactive oxygen species modulator 1 (ROMO1) ELISA Kit

abx518839-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Pig Reactive oxygen species modulator 1 (ROMO1) ELISA Kit

abx518842-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Romo1/ Reactive oxygen species modulator 1 ELISA Kit

E1277Mo 1 Kit
EUR 571

Mouse Reactive oxygen species modulator 1, Romo1 ELISA KIT

ELI-06180m 96 Tests
EUR 865

Bovine Reactive oxygen species modulator 1, ROMO1 ELISA KIT

ELI-06181b 96 Tests
EUR 928

Porcine Reactive oxygen species modulator 1, ROMO1 ELISA KIT

ELI-06182p 96 Tests
EUR 928

Rat ROMO1(Reactive oxygen species modulator 1) ELISA Kit

ER1611 96T
EUR 524.1
  • Detection range: 15.625-1000 pg/ml
  • Alias: Reactive oxygen species modulator 1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 9.375pg/ml

Mouse Romo1( Reactive oxygen species modulator 1) ELISA Kit

EM0699 96T
EUR 567.6
  • Detection range: 15.6-1000 pg/ml
  • Uniprot ID: P60603
  • Alias: Romo1/Reactive oxygen species modulator 1/ROS modulator 1/Protein MGR2 homolog/Mitochondrial targeting GxxxG motif protein/MTGM/Protein MGR2 homolog/Glyrichin
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 9.375pg/ml

Mouse Reactive oxygen species modulator 1 (ROMO1) ELISA Kit

abx255047-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Reactive Oxygen Species Modulator 1 (ROMO1) ELISA Kit

abx257722-96tests 96 tests
EUR 652
  • Shipped within 5-12 working days.

Rat Reactive Oxygen Species Modulator 1 (ROMO1) ELISA Kit

abx391904-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

for Reactive Oxygen Species Modulator 1 (ROMO1))ELISA kit

SEQ510Bo-10x96wellstestplate 10x96-wells test plate
EUR 5647.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Reactive Oxygen Species Modulator 1 (ROMO1)) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Reactive Oxygen Species Modulator 1 (ROMO1)) in Tissue homogenates, cell lysates and other biological fluids.

for Reactive Oxygen Species Modulator 1 (ROMO1))ELISA kit

SEQ510Bo-1x48wellstestplate 1x48-wells test plate
EUR 552.76
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Reactive Oxygen Species Modulator 1 (ROMO1)) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Reactive Oxygen Species Modulator 1 (ROMO1)) in Tissue homogenates, cell lysates and other biological fluids.

for Reactive Oxygen Species Modulator 1 (ROMO1))ELISA kit

SEQ510Bo-1x96wellstestplate 1x96-wells test plate
EUR 746.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Reactive Oxygen Species Modulator 1 (ROMO1)) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Reactive Oxygen Species Modulator 1 (ROMO1)) in Tissue homogenates, cell lysates and other biological fluids.

for Reactive Oxygen Species Modulator 1 (ROMO1))ELISA kit

SEQ510Bo-5x96wellstestplate 5x96-wells test plate
EUR 3060.6
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Reactive Oxygen Species Modulator 1 (ROMO1)) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Reactive Oxygen Species Modulator 1 (ROMO1)) in Tissue homogenates, cell lysates and other biological fluids.

"ELISA Kit for Reactive Oxygen Species Modulator 1 (ROMO1)"

  • EUR 5698.00
  • EUR 3011.00
  • EUR 747.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Reactive Oxygen Species Modulator 1 (ROMO1) elisa. Alternative names of the recognized antigen: C20orf52
  • Glyrichin
  • Mitochondrial Targeting GXXXG Protein
  • Epididymis tissue protein Li 175
  • Protein MGR2 homolog
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of "Reactive Oxygen Species Modulator 1 (ROMO1)" in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Reactive Oxygen Species Modulator 1 (ROMO1) CLIA Kit

  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Reactive Oxygen Species Modulator 1 (ROMO1) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Reactive Oxygen Species Modulator 1 (ROMO1) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Reactive Oxygen Species Modulator 1 (ROMO1) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Reactive Oxygen Species Modulator 1 (ROMO1) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ELISA kit for Human ROMO1 (Reactive oxygen species modulator 1)

E-EL-H5430 1 plate of 96 wells
EUR 534
  • Gentaur's ROMO1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human ROMO1. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human ROMO1 (Reactive oxygen species modulator 1) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human ROMO1 (Reactive Oxygen Species Modulator 1)

ELK6968 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Reactive Oxygen Species Modulator 1 (ROMO1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody sp
  • Show more
Description: A sandwich ELISA kit for detection of Reactive Oxygen Species Modulator 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Romo1 ELISA Kit| Mouse Reactive oxygen species modulator 1 ELIS

EF013312 96 Tests
EUR 689

ELISA kit for Rat Reactive oxygen species modulator 1 (ROMO1)

KTE100977-48T 48T
EUR 332
  • The main source of ROS is known to be the mitochondria, and increased levels of ROS from the mitochondria have been observed in many cancer cells. Thus far, the mechanism of ROS production in cancer cell proliferation in the mitochondria is not well-
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Reactive oxygen species modulator 1 (ROMO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Reactive oxygen species modulator 1 (ROMO1)

KTE100977-5platesof96wells 5 plates of 96 wells
EUR 2115
  • The main source of ROS is known to be the mitochondria, and increased levels of ROS from the mitochondria have been observed in many cancer cells. Thus far, the mechanism of ROS production in cancer cell proliferation in the mitochondria is not well-
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Reactive oxygen species modulator 1 (ROMO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Reactive oxygen species modulator 1 (ROMO1)

KTE100977-96T 96T
EUR 539
  • The main source of ROS is known to be the mitochondria, and increased levels of ROS from the mitochondria have been observed in many cancer cells. Thus far, the mechanism of ROS production in cancer cell proliferation in the mitochondria is not well-
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Reactive oxygen species modulator 1 (ROMO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ROMO1 ELISA Kit| Rat Reactive oxygen species modulator 1 ELISA K

EF018208 96 Tests
EUR 689

ELISA kit for Human Reactive oxygen species modulator 1

EK4091 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Reactive oxygen species modulator 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Mouse Reactive oxygen species modulator 1

EK4090 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Reactive oxygen species modulator 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human Reactive Oxygen Species (ROS) ELISA Kit

QY-E05580 96T
EUR 361

Mouse reactive oxygen species, ROS ELISA Kit

ELA-E1924m 96 Tests
EUR 865

Rat reactive oxygen species, ROS ELISA Kit

ELA-E1924r 96 Tests
EUR 886

Rat reactive oxygen species(ROS)ELISA Kit

GA-E0312RT-48T 48T
EUR 317

Rat reactive oxygen species(ROS)ELISA Kit

GA-E0312RT-96T 96T
EUR 496

Rat reactive oxygen species(ROS)ELISA Kit

QY-E11340 96T
EUR 361

Mouse reactive oxygen species(ROS)ELISA Kit

QY-E21305 96T
EUR 361

ELISA kit for Mouse Reactive oxygen species (ROS)

KTE71621-48T 48T
EUR 354
Description: Quantitative sandwich ELISA for measuring Mouse Reactive oxygen species (ROS) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Reactive oxygen species (ROS)

KTE71621-5platesof96wells 5 plates of 96 wells
EUR 2252
Description: Quantitative sandwich ELISA for measuring Mouse Reactive oxygen species (ROS) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Reactive oxygen species (ROS)

KTE71621-96T 96T
EUR 572
Description: Quantitative sandwich ELISA for measuring Mouse Reactive oxygen species (ROS) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Reactive Oxygen Species (ROS) Detection Assay Kit

EUR 267

Reactive Oxygen Species (ROS) Detection Assay Kit

EUR 316

Human Negative regulator of reactive oxygen species (NRROS)

  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 74.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Negative regulator of reactive oxygen species(NRROS),partial expressed in E.coli

Human Negative regulator of reactive oxygen species (NRROS)

  • EUR 840.00
  • EUR 332.00
  • EUR 2170.00
  • EUR 1135.00
  • EUR 1579.00
  • EUR 470.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 73.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Negative regulator of reactive oxygen species(NRROS),partial expressed in Baculovirus

Recombinant human Negative regulator of reactive oxygen species

P1956 100ug Ask for price
  • Uniprot ID: Q86YC3
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Negative regulator of reactive oxygen species

ROS Brite™ 570 *Optimized for Detecting Reactive Oxygen Species (ROS)*

16000 1 mg
EUR 219
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12352200

ROS Brite™ 670 *Optimized for Detecting Reactive Oxygen Species (ROS)*

16002 1 mg
EUR 219
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12352200

ROS Brite™ APF *Optimized for Detecting Reactive Oxygen Species (ROS)*

16050 1 mg
EUR 176
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12352200

ROS Brite™ HPF *Optimized for Detecting Reactive Oxygen Species (ROS)*

16051 1 mg
EUR 176
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12352200

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

MitoROS™ 580 *Optimized for Detecting Reactive Oxygen Species (ROS) in Mitochondria*

16052 500 Tests
EUR 219
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12352200

ELISA kit for Mouse Reactive nitrogen species (RNS)

KTE71622-48T 48T
EUR 354
Description: Quantitative sandwich ELISA for measuring Mouse Reactive nitrogen species (RNS) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Reactive nitrogen species (RNS)

KTE71622-5platesof96wells 5 plates of 96 wells
EUR 2252
Description: Quantitative sandwich ELISA for measuring Mouse Reactive nitrogen species (RNS) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Reactive nitrogen species (RNS)

KTE71622-96T 96T
EUR 572
Description: Quantitative sandwich ELISA for measuring Mouse Reactive nitrogen species (RNS) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Canine Reactive OXyen Species (ROS)

KTE20106-48T 48T
EUR 332
  • Reactive oxygen species (ROS) are chemically reactive chemical species containing oxygen. Examples include peroxides, superoxide, hydroxyl radical, and singlet oxygen. In a biological context, ROS are formed as a natural byproduct of the normal metab
  • Show more
Description: Quantitative sandwich ELISA for measuring Canine Reactive OXyen Species (ROS) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Canine Reactive OXyen Species (ROS)

KTE20106-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Reactive oxygen species (ROS) are chemically reactive chemical species containing oxygen. Examples include peroxides, superoxide, hydroxyl radical, and singlet oxygen. In a biological context, ROS are formed as a natural byproduct of the normal metab
  • Show more
Description: Quantitative sandwich ELISA for measuring Canine Reactive OXyen Species (ROS) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Canine Reactive OXyen Species (ROS)

KTE20106-96T 96T
EUR 539
  • Reactive oxygen species (ROS) are chemically reactive chemical species containing oxygen. Examples include peroxides, superoxide, hydroxyl radical, and singlet oxygen. In a biological context, ROS are formed as a natural byproduct of the normal metab
  • Show more
Description: Quantitative sandwich ELISA for measuring Canine Reactive OXyen Species (ROS) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.


ELA-E1924h 96 Tests
EUR 824


EF006102 96 Tests
EUR 689

Human C-Reactive Protein (CRP) AssayMax ELISA Kit

EC1001-1 96 Well Plate
EUR 396

Human Oxygen- regulated protein 1, RP1 ELISA KIT

ELI-15342h 96 Tests
EUR 824

Rat C-Reactive Protein (CRP) AssayMax ELISA Kit

ERC1001-1 96 Well Plate
EUR 396

Mouse C-Reactive Protein (CRP) AssayMax ELISA Kit

EMC1001-1 96 Well Plate
EUR 396

?-Amyloid Precursor Protein Modulator

B7842-1 1 mg
EUR 284
Description: ?-Amyloid Precursor Protein Modulator is a benzolactam derived PKC activator.Protein kinase C (PKC) belongs to a family of protein kinase enzymes involved in phosphorylating serine and threonine of other proteins.

C-Reactive Protein, Human fluids

EUR 185

CRP C-Reactive Protein Human

PROTP02741-1 Regular: 1mg
EUR 317
Description: Human CRP produced in Human plasma having a molecular mass of 114 kDa. ;It can be used as a marker for inflammation and also used for monitoring and prediction of future events in coronary artery disease.

Human Nodal modulator 1, NOMO1 ELISA KIT

ELI-23570h 96 Tests
EUR 824

Human NODAL Modulator 1 (NOMO1) ELISA Kit

abx381845-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Oxygen- regulated protein 1, Rp1 ELISA KIT

ELI-21635m 96 Tests
EUR 865

Bovine Oxygen- regulated protein 1, RP1 ELISA KIT

ELI-53166b 96 Tests
EUR 928

Human Modulator of apoptosis 1, MOAP1 ELISA KIT

ELI-20830h 96 Tests
EUR 824

Human Modulator of apoptosis 1 (MOAP1) ELISA Kit

abx385167-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

ROMO1 Antibody

47598-100ul 100ul
EUR 252


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ROMO1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ROMO1. Recognizes ROMO1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

MAP kinase fragment [Multiple species]

A1079-1 1 mg
EUR 108
Description: This Mitogen-activated protein kinase (MAP kinase) fragment has a peptide sequence of Lys-Tyr-Ile-His-Ser-Ala-Asn-Val-Leu.The MAP kinases are serine/threonine-specific protein kinasesbelonging to the CMGC (CDK/MAPK/GSK3/CLK) kinase group.

Sirtuin modulator 1

HY-19758A 1mg
EUR 153

GPR120 modulator 1

HY-50162 10mM/1mL
EUR 467

Autotaxin modulator 1

HY-12812 10mM/1mL
EUR 626

GPR120 modulator 1

A3441-10 10 mg
EUR 701
Description: GPR120 modulator 1 is useful for modulating G protein-coupled receptor 120 (GPR120).

GPR120 modulator 1

A3441-5 5 mg
EUR 547
Description: GPR120 modulator 1 is useful for modulating G protein-coupled receptor 120 (GPR120).

GPR120 modulator 1

A3441-5.1 10 mM (in 1mL DMSO)
EUR 598
Description: GPR120 modulator 1 is useful for modulating G protein-coupled receptor 120 (GPR120).

GPR120 modulator 1

A3441-50 50 mg
EUR 1805
Description: GPR120 modulator 1 is useful for modulating G protein-coupled receptor 120 (GPR120).

Mouse Nodal modulator 1, Nomo1 ELISA KIT

ELI-35311m 96 Tests
EUR 865

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

RIG-1 modulator 1

HY-107902 10mM/1mL
EUR 650

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Human Calcium homeostasis modulator protein 1(CALHM1) ELISA kit

E01C1320-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Calcium homeostasis modulator protein 1(CALHM1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Calcium homeostasis modulator protein 1(CALHM1) ELISA kit

E01C1320-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Calcium homeostasis modulator protein 1(CALHM1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Calcium homeostasis modulator protein 1(CALHM1) ELISA kit

E01C1320-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Calcium homeostasis modulator protein 1(CALHM1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Calcium homeostasis modulator protein 1, CALHM1 ELISA KIT

ELI-11081h 96 Tests
EUR 824

Human G- protein- signaling modulator 1, GPSM1 ELISA KIT

ELI-32665h 96 Tests
EUR 824

Human G-Protein-Signaling Modulator 1 (GPSM1) ELISA Kit

abx259383-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Calcium Homeostasis Modulator Protein 1 (CALHM1) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

ELISA kit for Human Modulator of apoptosis 1 (MOAP1)

KTE61574-48T 48T
EUR 332
  • Modulator of apoptosis 1 encoded by MOAP1 was identified by its interaction with apoptosis regulator BAX protein. This protein contains a Bcl-2 homology 3 (BH3)-like motif, which is required for the association with BAX. When overexpressed, MOAP1 has
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Modulator of apoptosis 1 (MOAP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Modulator of apoptosis 1 (MOAP1)

KTE61574-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Modulator of apoptosis 1 encoded by MOAP1 was identified by its interaction with apoptosis regulator BAX protein. This protein contains a Bcl-2 homology 3 (BH3)-like motif, which is required for the association with BAX. When overexpressed, MOAP1 has
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Modulator of apoptosis 1 (MOAP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Modulator of apoptosis 1 (MOAP1)

KTE61574-96T 96T
EUR 539
  • Modulator of apoptosis 1 encoded by MOAP1 was identified by its interaction with apoptosis regulator BAX protein. This protein contains a Bcl-2 homology 3 (BH3)-like motif, which is required for the association with BAX. When overexpressed, MOAP1 has
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Modulator of apoptosis 1 (MOAP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human ROMO1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ROMO1 Recombinant Protein (Human)

RP026752 100 ug Ask for price

eukaryotic translation elongation factor 1 alpha 1 (EEF1A1) (387-394) [Multiple species]

A1067-1 1 mg
EUR 108
Description: Sequence: LEU-GLU-ASP-GLY-PRO-LYS-PHE-LEUeukaryotic translation elongation factor 1 alpha 1 (EEF1A1) encodes an isoform of the alpha subunit of the elongation factor-1 complex, which is responsible for the enzymatic delivery of aminoacyl tRNAs to the ribosome.

ferritin heavy chain fragment [Multiple species]

A1069-1 1 mg
EUR 108
Description: Sequence: H2N-YLNEQVKAI-OHThe two heavy chains are colored red and blue and the two light chains green and yellow.Ferritin is a protein of 450 kDa consisting of 24 subunits that is present in every cell type.

Multiple Species Frozen Tissue Array - Brain

T6134035-1 1 slide
EUR 220
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.

Multiple Species Frozen Tissue Array - Liver

T6134149-1 1 slide
EUR 220
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.

Multi-species Stathmin 1 (STMN1) ELISA Kit

SEC892Mi-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Multi-species Stathmin 1 (STMN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Multi-species Stathmin 1 (STMN1) in tissue homogenates, cell lysates and other biological fluids.

Multi-species Stathmin 1 (STMN1) ELISA Kit

SEC892Mi-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Multi-species Stathmin 1 (STMN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Multi-species Stathmin 1 (STMN1) in tissue homogenates, cell lysates and other biological fluids.

Multi-species Stathmin 1 (STMN1) ELISA Kit

SEC892Mi-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Multi-species Stathmin 1 (STMN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Multi-species Stathmin 1 (STMN1) in tissue homogenates, cell lysates and other biological fluids.

Multi-species Stathmin 1 (STMN1) ELISA Kit

SEC892Mi-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Multi-species Stathmin 1 (STMN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Multi-species Stathmin 1 (STMN1) in tissue homogenates, cell lysates and other biological fluids.

Multi-species Stathmin 1 (STMN1) ELISA Kit

  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Stathmin 1 elisa. Alternative names of the recognized antigen: LAP18
  • C1orf215
  • Lag
  • OP18
  • PP17
  • PP19
  • PR22
  • SMN
  • Metablastin
  • Prosolin
  • Oncoprotein 18
  • Leukemia-associated phosphoprotein p18
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Multi-species Stathmin 1 (STMN1) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Anti-C Reactive Protein/Crp Antibody

A00249-1 100ug/vial
EUR 334

oxygen electrode, s8

SZ90Y ea
EUR 656

Human C Reactive Protein ELISA kit

E01C0009-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human C Reactive Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human C Reactive Protein ELISA kit

E01C0009-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human C Reactive Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human C Reactive Protein ELISA kit

E01C0009-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human C Reactive Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Nodal modulator 2, NOMO2 ELISA KIT

ELI-13101h 96 Tests
EUR 824

Human Nodal modulator 3, NOMO3 ELISA KIT

ELI-44126h 96 Tests
EUR 824

Human NODAL Modulator 2 (NOMO2) ELISA Kit

abx381846-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

ROMO1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1868502 1.0 ug DNA
EUR 154

Mouse Modulator of apoptosis 1, Moap1 ELISA KIT

ELI-20831m 96 Tests
EUR 865

Mouse Modulator of apoptosis 1 (MOAP1) ELISA Kit

abx389916-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Moap1 ELISA Kit| Mouse Modulator of apoptosis 1 ELISA Kit

EF015555 96 Tests
EUR 689

5-HT1A modulator 1

HY-100290 5mg
EUR 1084

gamma-secretase modulator 1

HY-10043 25mg
EUR 664

Calcium channel-modulator-1

HY-U00135 5mg
EUR 601

Opioid receptor modulator 1

HY-U00420 25mg
EUR 3035

NOT Receptor Modulator 1

HY-U00429 25mg
EUR 3035

Human Small G protein signaling modulator 1, SGSM1 ELISA KIT

ELI-52960h 96 Tests
EUR 824

Human Small G protein signaling modulator 1 (SGSM1) ELISA Kit

abx383162-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human DNA Damage Regulated Autophagy Modulator 1 (DRAM1) ELISA Kit

abx251626-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

ROMO1 Conjugated Antibody

C47598 100ul
EUR 397

ROMO1 cloning plasmid

CSB-CL020063HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 240
  • Sequence: atgccggtggccgtgggtccctacggacagtcccagccaagctgcttcgaccgtgtcaaaatgggcttcgtgatgggttgcgccgtgggcatggcggccggggcgctcttcggcaccttttcctgtctcaggatcggaatgcggggtcgagagctgatgggcggcattgggaaaac
  • Show more
Description: A cloning plasmid for the ROMO1 gene.

anti- ROMO1 antibody

FNab07383 100µg
EUR 585
  • Immunogen: reactive oxygen species modulator 1
  • Uniprot ID: P60602
  • Gene ID: 140823
  • Research Area: Immunology
Description: Antibody raised against ROMO1

ROMO1 Polyclonal Antibody

A60670 100 µg
EUR 570.55
Description: kits suitable for this type of research

Anti-ROMO1 antibody

PAab07383 100 ug
EUR 412

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

CRP C-Reactive Protein Rat Recombinant Protein

PROTP48199-1 Regular: 10ug
EUR 317
Description: CRP produced in Sf9 Insect cells is a single, glycosylated polypeptide chain containing 217 amino acids (20-230 a.a.) and having a molecular mass of 24.1kDa. (Molecular size on SDS-PAGE will appear at approximately 28-40 kDa).;CRP is expressed with a 6 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques.

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

Human NODAL Modulator 1 (NOMO1) Protein

  • EUR 634.00
  • EUR 272.00
  • EUR 1901.00
  • EUR 746.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Modulator of apoptosis 1 (MOAP1)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 66.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Modulator of apoptosis 1(MOAP1) expressed in E.coli

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

ROMO1 ORF Vector (Human) (pORF)

ORF008918 1.0 ug DNA
EUR 95

Gpsm1 ELISA Kit| Mouse G-protein-signaling modulator 1 ELISA Kit

EF014016 96 Tests
EUR 689

Human C-Reactive Protein (CRP) ELISA Kit

abx570001-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human CRP/ C-reactive protein ELISA Kit

E0562Hu 1 Kit
EUR 451

ELISA kit for Human C-reactive protein

EK2306 96 tests
EUR 284
Description: Enzyme-linked immunosorbent assay kit for quantification of Human C-reactive protein in samples from serum, plasma, tissue homogenates and other biological fluids.

C-Reactive Protein (CRP) (Human) ELISA Kit

EUR 539

Human CRP(C-Reactive Protein) ELISA Kit

EH0099 96T
EUR 476.25
  • Detection range: 31.2-2000 pg/ml
  • Uniprot ID: P02741
  • Alias: CRP(C-Reactive Protein)/PTX1/Pentraxin 1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 2pg/ml

Human C- reactive protein, CRP ELISA KIT

ELI-02800h 96 Tests
EUR 824

Human C-Reactive Protein(CRP)ELISA Kit

GA-E1815HM-48T 48T
EUR 289

Human C-Reactive Protein(CRP)ELISA Kit

GA-E1815HM-96T 96T
EUR 466

Human C-Reactive Protein (CRP) ELISA Kit

  • EUR 5311.00
  • EUR 2837.00
  • EUR 668.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human C Reactive Protein (CRP) ELISA Kit

  • EUR 5515.00
  • EUR 2947.00
  • EUR 692.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Ly1 Antibody Reactive (LYAR) ELISA Kit

abx388353-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human C-Reactive Protein (CRP) ELISA Kit

abx250236-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human C-Reactive Protein,CRP ELISA Kit

201-12-1799 96 tests
EUR 440
  • This C-Reactive Protein ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human C Reactive Protein (CRP) ELISA Kit

DLR-CRP-Hu-48T 48T
EUR 385
  • Should the Human C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, urine, cerebrospinal fluid, cell culture supernates or other biological fluids.

Human C Reactive Protein (CRP) ELISA Kit

DLR-CRP-Hu-96T 96T
EUR 492
  • Should the Human C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, urine, cerebrospinal fluid, cell culture supernates or other biological fluids.

Human C-Reactive Protein,CRP ELISA Kit

CN-03290H1 96T
EUR 458

Human C-Reactive Protein,CRP ELISA Kit

CN-03290H2 48T
EUR 307

Human C Reactive Protein (CRP) ELISA Kit

LF-EK60021 1×96T
EUR 679

Human C Reactive Protein (CRP) ELISA Kit

SEA821Hu-10x96wellstestplate 10x96-wells test plate
EUR 3127.98
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human C Reactive Protein (CRP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human C Reactive Protein (CRP) in serum, plasma, tissue homogenates, cell lysates, urine, cerebrospinal fluid, cell culture supernates and other biological fluids.

Human C Reactive Protein (CRP) ELISA Kit

SEA821Hu-1x48wellstestplate 1x48-wells test plate
EUR 345.25
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human C Reactive Protein (CRP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human C Reactive Protein (CRP) in serum, plasma, tissue homogenates, cell lysates, urine, cerebrospinal fluid, cell culture supernates and other biological fluids.

Human C Reactive Protein (CRP) ELISA Kit

SEA821Hu-1x96wellstestplate 1x96-wells test plate
EUR 450.35
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human C Reactive Protein (CRP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human C Reactive Protein (CRP) in serum, plasma, tissue homogenates, cell lysates, urine, cerebrospinal fluid, cell culture supernates and other biological fluids.

Human C Reactive Protein (CRP) ELISA Kit

SEA821Hu-5x96wellstestplate 5x96-wells test plate
EUR 1726.58
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human C Reactive Protein (CRP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human C Reactive Protein (CRP) in serum, plasma, tissue homogenates, cell lysates, urine, cerebrospinal fluid, cell culture supernates and other biological fluids.

Human C Reactive Protein (CRP) ELISA Kit

  • EUR 3178.00
  • EUR 1677.00
  • EUR 451.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as C Reactive Protein elisa. Alternative names of the recognized antigen: C-RP
  • PTX1
  • Pentraxin-Related
  • Pentraxin 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, urine, cerebrospinal fluid, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human C-Reactive Protein/CRP ELISA Kit

RK00078 96 Tests
EUR 521

Human C Reactive Protein (CRP) ELISA Kit

RDR-CRP-Hu-48Tests 48 Tests
EUR 388

Human C Reactive Protein (CRP) ELISA Kit

RDR-CRP-Hu-96Tests 96 Tests
EUR 533

Human C Reactive Protein (CRP) ELISA Kit

RD-CRP-Hu-48Tests 48 Tests
EUR 372

Human C Reactive Protein (CRP) ELISA Kit

RD-CRP-Hu-96Tests 96 Tests
EUR 510

Human C-Reactive Protein(CRP)ELISA Kit

QY-E04998 96T
EUR 361

Human C-Reactive Protein (CRP) ELISA Kit

STA-392 96 assays
EUR 676
Description: C-Reactive Protein (CRP), named for its capacity to precipitate the somatic C-polysaccharide of Streptococcus pneumoniae, was the first acute-phase protein to be described and is an exquisitely sensitive systemic marker of inflammation and tissue damage.  CRP belongs to the pentraxin family of calcium dependent ligand-binding plasma proteins.  Human CRP binds with highest affinity to phosphocholine residues, but it also binds to a variety of other autologous and extrinsic ligands, and it aggregates or precipitates the cellular, particulate, or molecular structures bearing these ligands. Cell Biolabs? Human CRP ELISA Kit is an enzyme immunoassay developed for the detection and quantitation of human CRP in plasma, serum or other biological fluid samples.  The kit has detection sensitivity limit of 1 ng/mL human CRP.  Each kit provides sufficient reagents to perform up to 96 assays including standard curve and unknown samples. 

Goat Calcium homeostasis modulator protein 1(CALHM1) ELISA kit

E06C1320-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Calcium homeostasis modulator protein 1(CALHM1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Calcium homeostasis modulator protein 1(CALHM1) ELISA kit

E06C1320-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Calcium homeostasis modulator protein 1(CALHM1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human ROMO1(Reactive Oxygen Species Modulator 1) ELISA Package