Human ROMO1(Reactive Oxygen Species Modulator 1) ELISA Kit

Human ROMO1(Reactive Oxygen Species Modulator 1) ELISA Package

Human Reactive Oxygen Species Modulator 1 (ROMO1) ELISA Kit
RDR-ROMO1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 589

Human Reactive Oxygen Species Modulator 1 (ROMO1) ELISA Kit
RDR-ROMO1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 820

Mouse Reactive Oxygen Species Modulator 1 (ROMO1) ELISA Kit
DLR-ROMO1-Mu-48T	DL Develop	48T	EUR 566
Should the Mouse Reactive Oxygen Species Modulator 1 (ROMO1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Reactive Oxygen Species Modulator 1 (ROMO1) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Reactive Oxygen Species Modulator 1 (ROMO1) ELISA Kit
DLR-ROMO1-Mu-96T	DL Develop	96T	EUR 741
Should the Mouse Reactive Oxygen Species Modulator 1 (ROMO1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Reactive Oxygen Species Modulator 1 (ROMO1) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Reactive Oxygen Species Modulator 1 (ROMO1) ELISA Kit
RD-ROMO1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 577

Mouse Reactive Oxygen Species Modulator 1 (ROMO1) ELISA Kit
RD-ROMO1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 802

Mouse Reactive Oxygen Species Modulator 1 (ROMO1) ELISA Kit
RDR-ROMO1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 603

Mouse Reactive Oxygen Species Modulator 1 (ROMO1) ELISA Kit
RDR-ROMO1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 840

Reactive Oxygen Species Modulator 1 (ROMO1) Antibody
20-abx174338	Abbexa	EUR 926.00 EUR 467.00	1 mg 200 ug
Please enquire.

Reactive Oxygen Species Modulator 1 (ROMO1) Antibody
20-abx178215	Abbexa	EUR 1316.00 EUR 620.00	1 mg 200 ug
Please enquire.

Reactive Oxygen Species Modulator 1 (ROMO1) Antibody
abx237383-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Reactive Oxygen Species Modulator 1 (ROMO1) Antibody
20-abx305165	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Mouse Reactive oxygen species modulator 1 (Romo1)
1-CSB-CF020063MO	Cusabio	EUR 1163.00 EUR 437.00 EUR 693.00	1MG 200ug 500ug
MW: 11.0 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Reactive oxygen species modulator 1(Romo1) expressed in in vitro E.coli expression system

Human Reactive oxygen species modulator 1 (ROMO1) ELISA Kit
abx571602-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human ROMO1/ Reactive oxygen species modulator 1 ELISA Kit
E2168Hu	Sunlong	1 Kit	EUR 571

Human ROMO1(Reactive oxygen species modulator 1) ELISA Kit
EH2003	FN Test	96T	EUR 567.6
Detection range: 31.2-2000 pg/ml Uniprot ID: P60602 Alias: ROMO1/Reactive oxygen species modulator 1/ROS modulator 1/Protein MGR2 homolog/Mitochondrial targeting GxxxG motif protein/MTGM/Protein MGR2 homolog/Glyrichin
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

Human Reactive oxygen species modulator 1, ROMO1 ELISA KIT
ELI-06179h	Lifescience Market	96 Tests	EUR 824

Human Reactive Oxygen Species Modulator 1 (ROMO1) ELISA Kit
20-abx152978	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Reactive oxygen species modulator 1 (ROMO1) ELISA Kit
abx251327-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Reactive Oxygen Species Modulator 1 (ROMO1) ELISA Kit
SEQ510Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5189.65
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reactive Oxygen Species Modulator 1 (ROMO1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reactive Oxygen Species Modulator 1 (ROMO1) in Tissue homogenates, cell lysates and other biological fluids.

Human Reactive Oxygen Species Modulator 1 (ROMO1) ELISA Kit
SEQ510Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 515.03
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reactive Oxygen Species Modulator 1 (ROMO1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reactive Oxygen Species Modulator 1 (ROMO1) in Tissue homogenates, cell lysates and other biological fluids.

Human Reactive Oxygen Species Modulator 1 (ROMO1) ELISA Kit
SEQ510Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 692.9
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reactive Oxygen Species Modulator 1 (ROMO1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reactive Oxygen Species Modulator 1 (ROMO1) in Tissue homogenates, cell lysates and other biological fluids.

Human Reactive Oxygen Species Modulator 1 (ROMO1) ELISA Kit
SEQ510Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2818.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reactive Oxygen Species Modulator 1 (ROMO1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reactive Oxygen Species Modulator 1 (ROMO1) in Tissue homogenates, cell lysates and other biological fluids.

Human Reactive Oxygen Species Modulator 1 (ROMO1) ELISA Kit
4-SEQ510Hu	Cloud-Clone	EUR 5240.00 EUR 2769.00 EUR 693.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Reactive Oxygen Species Modulator 1 elisa. Alternative names of the recognized antigen: C20orf52 MTGMP Glyrichin Mitochondrial Targeting GXXXG Protein Epididymis tissue protein Li 175 Protein MGR2 homolog
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Reactive Oxygen Species Modulator 1 (ROMO1) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Reactive Oxygen Species Modulator 1 (ROMO1) Protein
20-abx654907	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Cow Reactive oxygen species modulator 1 (ROMO1) ELISA Kit
abx518839-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Pig Reactive oxygen species modulator 1 (ROMO1) ELISA Kit
abx518842-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Romo1/ Reactive oxygen species modulator 1 ELISA Kit
E1277Mo	Sunlong	1 Kit	EUR 571

Mouse Reactive oxygen species modulator 1, Romo1 ELISA KIT
ELI-06180m	Lifescience Market	96 Tests	EUR 865

Bovine Reactive oxygen species modulator 1, ROMO1 ELISA KIT
ELI-06181b	Lifescience Market	96 Tests	EUR 928

Porcine Reactive oxygen species modulator 1, ROMO1 ELISA KIT
ELI-06182p	Lifescience Market	96 Tests	EUR 928

Rat ROMO1(Reactive oxygen species modulator 1) ELISA Kit
ER1611	FN Test	96T	EUR 524.1
Detection range: 15.625-1000 pg/ml Alias: Reactive oxygen species modulator 1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 9.375pg/ml

Mouse Romo1( Reactive oxygen species modulator 1) ELISA Kit
EM0699	FN Test	96T	EUR 567.6
Detection range: 15.6-1000 pg/ml Uniprot ID: P60603 Alias: Romo1/Reactive oxygen species modulator 1/ROS modulator 1/Protein MGR2 homolog/Mitochondrial targeting GxxxG motif protein/MTGM/Protein MGR2 homolog/Glyrichin
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 9.375pg/ml

Mouse Reactive oxygen species modulator 1 (ROMO1) ELISA Kit
abx255047-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Rat Reactive Oxygen Species Modulator 1 (ROMO1) ELISA Kit
abx257722-96tests	Abbexa	96 tests	EUR 652
Shipped within 5-12 working days.

Rat Reactive Oxygen Species Modulator 1 (ROMO1) ELISA Kit
abx391904-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

for Reactive Oxygen Species Modulator 1 (ROMO1))ELISA kit
SEQ510Bo-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5647.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Reactive Oxygen Species Modulator 1 (ROMO1)) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter- Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Reactive Oxygen Species Modulator 1 (ROMO1)) in Tissue homogenates, cell lysates and other biological fluids.

for Reactive Oxygen Species Modulator 1 (ROMO1))ELISA kit
SEQ510Bo-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 552.76
The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Reactive Oxygen Species Modulator 1 (ROMO1)) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter- Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Reactive Oxygen Species Modulator 1 (ROMO1)) in Tissue homogenates, cell lysates and other biological fluids.

for Reactive Oxygen Species Modulator 1 (ROMO1))ELISA kit
SEQ510Bo-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 746.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Reactive Oxygen Species Modulator 1 (ROMO1)) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter- Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Reactive Oxygen Species Modulator 1 (ROMO1)) in Tissue homogenates, cell lysates and other biological fluids.

for Reactive Oxygen Species Modulator 1 (ROMO1))ELISA kit
SEQ510Bo-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 3060.6
The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Reactive Oxygen Species Modulator 1 (ROMO1)) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter- Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Reactive Oxygen Species Modulator 1 (ROMO1)) in Tissue homogenates, cell lysates and other biological fluids.

"ELISA Kit for Reactive Oxygen Species Modulator 1 (ROMO1)"
4-SEQ510Bo	Cloud-Clone	EUR 5698.00 EUR 3011.00 EUR 747.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Reactive Oxygen Species Modulator 1 (ROMO1) elisa. Alternative names of the recognized antigen: C20orf52 MTGMP Glyrichin Mitochondrial Targeting GXXXG Protein Epididymis tissue protein Li 175 Protein MGR2 homolog
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of "Reactive Oxygen Species Modulator 1 (ROMO1)" in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Reactive Oxygen Species Modulator 1 (ROMO1) CLIA Kit
20-abx496194	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Mouse Reactive Oxygen Species Modulator 1 (ROMO1) Protein
20-abx650868	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Reactive Oxygen Species Modulator 1 (ROMO1) Antibody (HRP)
20-abx305166	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Reactive Oxygen Species Modulator 1 (ROMO1) Antibody (FITC)
20-abx305167	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Reactive Oxygen Species Modulator 1 (ROMO1) Antibody (Biotin)
20-abx305168	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

ELISA kit for Human ROMO1 (Reactive oxygen species modulator 1)
E-EL-H5430	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's ROMO1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human ROMO1. Standards or samples are added to the micro ELISA plate wells and combined with Show more
Description: A sandwich ELISA kit for quantitative measurement of Human ROMO1 (Reactive oxygen species modulator 1) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human ROMO1 (Reactive Oxygen Species Modulator 1)
ELK6968	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Reactive Oxygen Species Modulator 1 (ROMO1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody sp Show more
Description: A sandwich ELISA kit for detection of Reactive Oxygen Species Modulator 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Romo1 ELISA Kit| Mouse Reactive oxygen species modulator 1 ELIS
EF013312	Lifescience Market	96 Tests	EUR 689

ELISA kit for Rat Reactive oxygen species modulator 1 (ROMO1)
KTE100977-48T	Abbkine	48T	EUR 332
The main source of ROS is known to be the mitochondria, and increased levels of ROS from the mitochondria have been observed in many cancer cells. Thus far, the mechanism of ROS production in cancer cell proliferation in the mitochondria is not well- Show more
Description: Quantitative sandwich ELISA for measuring Rat Reactive oxygen species modulator 1 (ROMO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Reactive oxygen species modulator 1 (ROMO1)
KTE100977-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
The main source of ROS is known to be the mitochondria, and increased levels of ROS from the mitochondria have been observed in many cancer cells. Thus far, the mechanism of ROS production in cancer cell proliferation in the mitochondria is not well- Show more
Description: Quantitative sandwich ELISA for measuring Rat Reactive oxygen species modulator 1 (ROMO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Reactive oxygen species modulator 1 (ROMO1)
KTE100977-96T	Abbkine	96T	EUR 539
The main source of ROS is known to be the mitochondria, and increased levels of ROS from the mitochondria have been observed in many cancer cells. Thus far, the mechanism of ROS production in cancer cell proliferation in the mitochondria is not well- Show more
Description: Quantitative sandwich ELISA for measuring Rat Reactive oxygen species modulator 1 (ROMO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ROMO1 ELISA Kit| Rat Reactive oxygen species modulator 1 ELISA K
EF018208	Lifescience Market	96 Tests	EUR 689

ELISA kit for Human Reactive oxygen species modulator 1
EK4091	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Reactive oxygen species modulator 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Mouse Reactive oxygen species modulator 1
EK4090	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Reactive oxygen species modulator 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human Reactive Oxygen Species (ROS) ELISA Kit
QY-E05580	Qayee Biotechnology	96T	EUR 361

Mouse reactive oxygen species, ROS ELISA Kit
ELA-E1924m	Lifescience Market	96 Tests	EUR 865

Rat reactive oxygen species, ROS ELISA Kit
ELA-E1924r	Lifescience Market	96 Tests	EUR 886

Rat reactive oxygen species(ROS)ELISA Kit
GA-E0312RT-48T	GenAsia Biotech	48T	EUR 317

Rat reactive oxygen species(ROS)ELISA Kit
GA-E0312RT-96T	GenAsia Biotech	96T	EUR 496

Rat reactive oxygen species(ROS)ELISA Kit
QY-E11340	Qayee Biotechnology	96T	EUR 361

Mouse reactive oxygen species(ROS)ELISA Kit
QY-E21305	Qayee Biotechnology	96T	EUR 361

ELISA kit for Mouse Reactive oxygen species (ROS)
KTE71621-48T	Abbkine	48T	EUR 354
Description: Quantitative sandwich ELISA for measuring Mouse Reactive oxygen species (ROS) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Reactive oxygen species (ROS)
KTE71621-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Description: Quantitative sandwich ELISA for measuring Mouse Reactive oxygen species (ROS) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Reactive oxygen species (ROS)
KTE71621-96T	Abbkine	96T	EUR 572
Description: Quantitative sandwich ELISA for measuring Mouse Reactive oxygen species (ROS) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Reactive Oxygen Species (ROS) Detection Assay Kit
K936-100	Biovision		EUR 267

Reactive Oxygen Species (ROS) Detection Assay Kit
K936-250	Biovision		EUR 316

Human Negative regulator of reactive oxygen species (NRROS)
1-CSB-EP801264HU	Cusabio	EUR 611.00 EUR 309.00 EUR 1827.00 EUR 939.00 EUR 1218.00 EUR 397.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 74.5 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Negative regulator of reactive oxygen species(NRROS),partial expressed in E.coli

Human Negative regulator of reactive oxygen species (NRROS)
1-CSB-BP801264HU	Cusabio	EUR 840.00 EUR 332.00 EUR 2170.00 EUR 1135.00 EUR 1579.00 EUR 470.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 73.5 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Negative regulator of reactive oxygen species(NRROS),partial expressed in Baculovirus

Recombinant human Negative regulator of reactive oxygen species
P1956	FN Test	100ug	Ask for price
Uniprot ID: Q86YC3 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Negative regulator of reactive oxygen species

ROS Brite™ 570 *Optimized for Detecting Reactive Oxygen Species (ROS)*
16000	AAT Bioquest	1 mg	EUR 219
R-phrase: R20, R21, R22 H-Phrase: H303, H313, H333 Symbol for dangerous compounds: Xn UNSPEC Code: 12352200

ROS Brite™ 670 *Optimized for Detecting Reactive Oxygen Species (ROS)*
16002	AAT Bioquest	1 mg	EUR 219
R-phrase: R20, R21, R22 H-Phrase: H303, H313, H333 Symbol for dangerous compounds: Xn UNSPEC Code: 12352200

ROS Brite™ APF *Optimized for Detecting Reactive Oxygen Species (ROS)*
16050	AAT Bioquest	1 mg	EUR 176
R-phrase: R20, R21, R22 H-Phrase: H303, H313, H333 Symbol for dangerous compounds: Xn UNSPEC Code: 12352200

ROS Brite™ HPF *Optimized for Detecting Reactive Oxygen Species (ROS)*
16051	AAT Bioquest	1 mg	EUR 176
R-phrase: R20, R21, R22 H-Phrase: H303, H313, H333 Symbol for dangerous compounds: Xn UNSPEC Code: 12352200

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

MitoROS™ 580 *Optimized for Detecting Reactive Oxygen Species (ROS) in Mitochondria*
16052	AAT Bioquest	500 Tests	EUR 219
R-phrase: R20, R21, R22 H-Phrase: H303, H313, H333 Symbol for dangerous compounds: Xn UNSPEC Code: 12352200

ELISA kit for Mouse Reactive nitrogen species (RNS)
KTE71622-48T	Abbkine	48T	EUR 354
Description: Quantitative sandwich ELISA for measuring Mouse Reactive nitrogen species (RNS) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Reactive nitrogen species (RNS)
KTE71622-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Description: Quantitative sandwich ELISA for measuring Mouse Reactive nitrogen species (RNS) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Reactive nitrogen species (RNS)
KTE71622-96T	Abbkine	96T	EUR 572
Description: Quantitative sandwich ELISA for measuring Mouse Reactive nitrogen species (RNS) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Canine Reactive OXyen Species (ROS)
KTE20106-48T	Abbkine	48T	EUR 332
Reactive oxygen species (ROS) are chemically reactive chemical species containing oxygen. Examples include peroxides, superoxide, hydroxyl radical, and singlet oxygen. In a biological context, ROS are formed as a natural byproduct of the normal metab Show more
Description: Quantitative sandwich ELISA for measuring Canine Reactive OXyen Species (ROS) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Canine Reactive OXyen Species (ROS)
KTE20106-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Reactive oxygen species (ROS) are chemically reactive chemical species containing oxygen. Examples include peroxides, superoxide, hydroxyl radical, and singlet oxygen. In a biological context, ROS are formed as a natural byproduct of the normal metab Show more
Description: Quantitative sandwich ELISA for measuring Canine Reactive OXyen Species (ROS) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Canine Reactive OXyen Species (ROS)
KTE20106-96T	Abbkine	96T	EUR 539
Reactive oxygen species (ROS) are chemically reactive chemical species containing oxygen. Examples include peroxides, superoxide, hydroxyl radical, and singlet oxygen. In a biological context, ROS are formed as a natural byproduct of the normal metab Show more
Description: Quantitative sandwich ELISA for measuring Canine Reactive OXyen Species (ROS) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human ROMO1 ELISA Kit
ELA-E1924h	Lifescience Market	96 Tests	EUR 824

ROMO1 ELISA KIT|Human
EF006102	Lifescience Market	96 Tests	EUR 689

Human C-Reactive Protein (CRP) AssayMax ELISA Kit
EC1001-1	AssayPro	96 Well Plate	EUR 396

Human Oxygen- regulated protein 1, RP1 ELISA KIT
ELI-15342h	Lifescience Market	96 Tests	EUR 824

Rat C-Reactive Protein (CRP) AssayMax ELISA Kit
ERC1001-1	AssayPro	96 Well Plate	EUR 396

Mouse C-Reactive Protein (CRP) AssayMax ELISA Kit
EMC1001-1	AssayPro	96 Well Plate	EUR 396

?-Amyloid Precursor Protein Modulator
B7842-1	ApexBio	1 mg	EUR 284
Description: ?-Amyloid Precursor Protein Modulator is a benzolactam derived PKC activator.Protein kinase C (PKC) belongs to a family of protein kinase enzymes involved in phosphorylating serine and threonine of other proteins.

C-Reactive Protein, Human fluids
P1441-1	Biovision		EUR 185

CRP C-Reactive Protein Human
PROTP02741-1	BosterBio	Regular: 1mg	EUR 317
Description: Human CRP produced in Human plasma having a molecular mass of 114 kDa. ;It can be used as a marker for inflammation and also used for monitoring and prediction of future events in coronary artery disease.

Human Nodal modulator 1, NOMO1 ELISA KIT
ELI-23570h	Lifescience Market	96 Tests	EUR 824

Human NODAL Modulator 1 (NOMO1) ELISA Kit
abx381845-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Oxygen- regulated protein 1, Rp1 ELISA KIT
ELI-21635m	Lifescience Market	96 Tests	EUR 865

Bovine Oxygen- regulated protein 1, RP1 ELISA KIT
ELI-53166b	Lifescience Market	96 Tests	EUR 928

Human Modulator of apoptosis 1, MOAP1 ELISA KIT
ELI-20830h	Lifescience Market	96 Tests	EUR 824

Human Modulator of apoptosis 1 (MOAP1) ELISA Kit
abx385167-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

ROMO1 Antibody
47598-100ul	SAB	100ul	EUR 252

ROMO1 siRNA
20-abx931845	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ROMO1 siRNA
20-abx931846	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ROMO1 Antibody
1-CSB-PA020063LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ROMO1. Recognizes ROMO1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

MAP kinase fragment [Multiple species]
A1079-1	ApexBio	1 mg	EUR 108
Description: This Mitogen-activated protein kinase (MAP kinase) fragment has a peptide sequence of Lys-Tyr-Ile-His-Ser-Ala-Asn-Val-Leu.The MAP kinases are serine/threonine-specific protein kinasesbelonging to the CMGC (CDK/MAPK/GSK3/CLK) kinase group.

Sirtuin modulator 1
HY-19758A	MedChemExpress	1mg	EUR 153

GPR120 modulator 1
HY-50162	MedChemExpress	10mM/1mL	EUR 467

Autotaxin modulator 1
HY-12812	MedChemExpress	10mM/1mL	EUR 626

GPR120 modulator 1
A3441-10	ApexBio	10 mg	EUR 701
Description: GPR120 modulator 1 is useful for modulating G protein-coupled receptor 120 (GPR120).

GPR120 modulator 1
A3441-5	ApexBio	5 mg	EUR 547
Description: GPR120 modulator 1 is useful for modulating G protein-coupled receptor 120 (GPR120).

GPR120 modulator 1
A3441-5.1	ApexBio	10 mM (in 1mL DMSO)	EUR 598
Description: GPR120 modulator 1 is useful for modulating G protein-coupled receptor 120 (GPR120).

GPR120 modulator 1
A3441-50	ApexBio	50 mg	EUR 1805
Description: GPR120 modulator 1 is useful for modulating G protein-coupled receptor 120 (GPR120).

Mouse Nodal modulator 1, Nomo1 ELISA KIT
ELI-35311m	Lifescience Market	96 Tests	EUR 865

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1	SBI	25 ul each	EUR 627
Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1	SBI	5 reactions	EUR 1152
Category: Stem Cell Products

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

RIG-1 modulator 1
HY-107902	MedChemExpress	10mM/1mL	EUR 650

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

Human Calcium homeostasis modulator protein 1(CALHM1) ELISA kit
E01C1320-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Calcium homeostasis modulator protein 1(CALHM1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Calcium homeostasis modulator protein 1(CALHM1) ELISA kit
E01C1320-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Calcium homeostasis modulator protein 1(CALHM1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Calcium homeostasis modulator protein 1(CALHM1) ELISA kit
E01C1320-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Calcium homeostasis modulator protein 1(CALHM1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Calcium homeostasis modulator protein 1, CALHM1 ELISA KIT
ELI-11081h	Lifescience Market	96 Tests	EUR 824

Human G- protein- signaling modulator 1, GPSM1 ELISA KIT
ELI-32665h	Lifescience Market	96 Tests	EUR 824

Human G-Protein-Signaling Modulator 1 (GPSM1) ELISA Kit
abx259383-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Calcium Homeostasis Modulator Protein 1 (CALHM1) ELISA Kit
20-abx386261	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-12 working days.

ELISA kit for Human Modulator of apoptosis 1 (MOAP1)
KTE61574-48T	Abbkine	48T	EUR 332
Modulator of apoptosis 1 encoded by MOAP1 was identified by its interaction with apoptosis regulator BAX protein. This protein contains a Bcl-2 homology 3 (BH3)-like motif, which is required for the association with BAX. When overexpressed, MOAP1 has Show more
Description: Quantitative sandwich ELISA for measuring Human Modulator of apoptosis 1 (MOAP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Modulator of apoptosis 1 (MOAP1)
KTE61574-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Modulator of apoptosis 1 encoded by MOAP1 was identified by its interaction with apoptosis regulator BAX protein. This protein contains a Bcl-2 homology 3 (BH3)-like motif, which is required for the association with BAX. When overexpressed, MOAP1 has Show more
Description: Quantitative sandwich ELISA for measuring Human Modulator of apoptosis 1 (MOAP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Modulator of apoptosis 1 (MOAP1)
KTE61574-96T	Abbkine	96T	EUR 539
Modulator of apoptosis 1 encoded by MOAP1 was identified by its interaction with apoptosis regulator BAX protein. This protein contains a Bcl-2 homology 3 (BH3)-like motif, which is required for the association with BAX. When overexpressed, MOAP1 has Show more
Description: Quantitative sandwich ELISA for measuring Human Modulator of apoptosis 1 (MOAP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human ROMO1 shRNA Plasmid
20-abx965325	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

ROMO1 Recombinant Protein (Human)
RP026752	ABM	100 ug	Ask for price

eukaryotic translation elongation factor 1 alpha 1 (EEF1A1) (387-394) [Multiple species]
A1067-1	ApexBio	1 mg	EUR 108
Description: Sequence: LEU-GLU-ASP-GLY-PRO-LYS-PHE-LEUeukaryotic translation elongation factor 1 alpha 1 (EEF1A1) encodes an isoform of the alpha subunit of the elongation factor-1 complex, which is responsible for the enzymatic delivery of aminoacyl tRNAs to the ribosome.

ferritin heavy chain fragment [Multiple species]
A1069-1	ApexBio	1 mg	EUR 108
Description: Sequence: H2N-YLNEQVKAI-OHThe two heavy chains are colored red and blue and the two light chains green and yellow.Ferritin is a protein of 450 kDa consisting of 24 subunits that is present in every cell type.

Multiple Species Frozen Tissue Array - Brain
T6134035-1	Biochain	1 slide	EUR 220
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.

Multiple Species Frozen Tissue Array - Liver
T6134149-1	Biochain	1 slide	EUR 220
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.

Multi-species Stathmin 1 (STMN1) ELISA Kit
SEC892Mi-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5124.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Multi-species Stathmin 1 (STMN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Multi-species Stathmin 1 (STMN1) in tissue homogenates, cell lysates and other biological fluids.

Multi-species Stathmin 1 (STMN1) ELISA Kit
SEC892Mi-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 509.64
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Multi-species Stathmin 1 (STMN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Multi-species Stathmin 1 (STMN1) in tissue homogenates, cell lysates and other biological fluids.

Multi-species Stathmin 1 (STMN1) ELISA Kit
SEC892Mi-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 685.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Multi-species Stathmin 1 (STMN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Multi-species Stathmin 1 (STMN1) in tissue homogenates, cell lysates and other biological fluids.

Multi-species Stathmin 1 (STMN1) ELISA Kit
SEC892Mi-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2783.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Multi-species Stathmin 1 (STMN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Multi-species Stathmin 1 (STMN1) in tissue homogenates, cell lysates and other biological fluids.

Multi-species Stathmin 1 (STMN1) ELISA Kit
4-SEC892Mi	Cloud-Clone	EUR 5175.00 EUR 2734.00 EUR 686.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Stathmin 1 elisa. Alternative names of the recognized antigen: LAP18 C1orf215 Lag OP18 PP17 PP19 PR22 SMN Metablastin Prosolin Oncoprotein 18 Leukemia-associated phosphoprotein p18
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Multi-species Stathmin 1 (STMN1) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Anti-C Reactive Protein/Crp Antibody
A00249-1	BosterBio	100ug/vial	EUR 334

oxygen electrode, s8
SZ90Y	Consort	ea	EUR 656

Human C Reactive Protein ELISA kit
E01C0009-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human C Reactive Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human C Reactive Protein ELISA kit
E01C0009-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human C Reactive Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human C Reactive Protein ELISA kit
E01C0009-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human C Reactive Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Nodal modulator 2, NOMO2 ELISA KIT
ELI-13101h	Lifescience Market	96 Tests	EUR 824

Human Nodal modulator 3, NOMO3 ELISA KIT
ELI-44126h	Lifescience Market	96 Tests	EUR 824

Human NODAL Modulator 2 (NOMO2) ELISA Kit
abx381846-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

ROMO1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1868502	ABM	1.0 ug DNA	EUR 154

Mouse Modulator of apoptosis 1, Moap1 ELISA KIT
ELI-20831m	Lifescience Market	96 Tests	EUR 865

Mouse Modulator of apoptosis 1 (MOAP1) ELISA Kit
abx389916-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Moap1 ELISA Kit| Mouse Modulator of apoptosis 1 ELISA Kit
EF015555	Lifescience Market	96 Tests	EUR 689

5-HT1A modulator 1
HY-100290	MedChemExpress	5mg	EUR 1084

gamma-secretase modulator 1
HY-10043	MedChemExpress	25mg	EUR 664

Calcium channel-modulator-1
HY-U00135	MedChemExpress	5mg	EUR 601

Opioid receptor modulator 1
HY-U00420	MedChemExpress	25mg	EUR 3035

NOT Receptor Modulator 1
HY-U00429	MedChemExpress	25mg	EUR 3035

Human Small G protein signaling modulator 1, SGSM1 ELISA KIT
ELI-52960h	Lifescience Market	96 Tests	EUR 824

Human Small G protein signaling modulator 1 (SGSM1) ELISA Kit
abx383162-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human DNA Damage Regulated Autophagy Modulator 1 (DRAM1) ELISA Kit
abx251626-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

ROMO1 Conjugated Antibody
C47598	SAB	100ul	EUR 397

ROMO1 cloning plasmid
CSB-CL020063HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 240 Sequence: atgccggtggccgtgggtccctacggacagtcccagccaagctgcttcgaccgtgtcaaaatgggcttcgtgatgggttgcgccgtgggcatggcggccggggcgctcttcggcaccttttcctgtctcaggatcggaatgcggggtcgagagctgatgggcggcattgggaaaac Show more
Description: A cloning plasmid for the ROMO1 gene.

anti- ROMO1 antibody
FNab07383	FN Test	100µg	EUR 585
Immunogen: reactive oxygen species modulator 1 Uniprot ID: P60602 Gene ID: 140823 Research Area: Immunology
Description: Antibody raised against ROMO1

ROMO1 Polyclonal Antibody
A60670	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

Anti-ROMO1 antibody
PAab07383	Lifescience Market	100 ug	EUR 412

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

CRP C-Reactive Protein Rat Recombinant Protein
PROTP48199-1	BosterBio	Regular: 10ug	EUR 317
Description: CRP produced in Sf9 Insect cells is a single, glycosylated polypeptide chain containing 217 amino acids (20-230 a.a.) and having a molecular mass of 24.1kDa. (Molecular size on SDS-PAGE will appear at approximately 28-40 kDa).;CRP is expressed with a 6 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques.

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

Human NODAL Modulator 1 (NOMO1) Protein
20-abx650785	Abbexa	EUR 634.00 EUR 272.00 EUR 1901.00 EUR 746.00 EUR 453.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Modulator of apoptosis 1 (MOAP1)
1-CSB-EP014693HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 66.5 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Modulator of apoptosis 1(MOAP1) expressed in E.coli

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

ROMO1 ORF Vector (Human) (pORF)
ORF008918	ABM	1.0 ug DNA	EUR 95

Gpsm1 ELISA Kit| Mouse G-protein-signaling modulator 1 ELISA Kit
EF014016	Lifescience Market	96 Tests	EUR 689

Human C-Reactive Protein (CRP) ELISA Kit
abx570001-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human CRP/ C-reactive protein ELISA Kit
E0562Hu	Sunlong	1 Kit	EUR 451

ELISA kit for Human C-reactive protein
EK2306	SAB	96 tests	EUR 284
Description: Enzyme-linked immunosorbent assay kit for quantification of Human C-reactive protein in samples from serum, plasma, tissue homogenates and other biological fluids.

C-Reactive Protein (CRP) (Human) ELISA Kit
E4289-100	Biovision		EUR 539

Human CRP(C-Reactive Protein) ELISA Kit
EH0099	FN Test	96T	EUR 476.25
Detection range: 31.2-2000 pg/ml Uniprot ID: P02741 Alias: CRP(C-Reactive Protein)/PTX1/Pentraxin 1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 2pg/ml

Human C- reactive protein, CRP ELISA KIT
ELI-02800h	Lifescience Market	96 Tests	EUR 824

Human C-Reactive Protein(CRP)ELISA Kit
GA-E1815HM-48T	GenAsia Biotech	48T	EUR 289

Human C-Reactive Protein(CRP)ELISA Kit
GA-E1815HM-96T	GenAsia Biotech	96T	EUR 466

Human C-Reactive Protein (CRP) ELISA Kit
20-abx150848	Abbexa	EUR 5311.00 EUR 2837.00 EUR 668.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human C Reactive Protein (CRP) ELISA Kit
20-abx151187	Abbexa	EUR 5515.00 EUR 2947.00 EUR 692.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Ly1 Antibody Reactive (LYAR) ELISA Kit
abx388353-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human C-Reactive Protein (CRP) ELISA Kit
abx250236-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human C-Reactive Protein,CRP ELISA Kit
201-12-1799	SunredBio	96 tests	EUR 440
This C-Reactive Protein ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human C Reactive Protein (CRP) ELISA Kit
DLR-CRP-Hu-48T	DL Develop	48T	EUR 385
Should the Human C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, urine, cerebrospinal fluid, cell culture supernates or other biological fluids.

Human C Reactive Protein (CRP) ELISA Kit
DLR-CRP-Hu-96T	DL Develop	96T	EUR 492
Should the Human C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, urine, cerebrospinal fluid, cell culture supernates or other biological fluids.

Human C-Reactive Protein,CRP ELISA Kit
CN-03290H1	ChemNorm	96T	EUR 458

Human C-Reactive Protein,CRP ELISA Kit
CN-03290H2	ChemNorm	48T	EUR 307

Human C Reactive Protein (CRP) ELISA Kit
LF-EK60021	Abfrontier	1×96T	EUR 679

Human C Reactive Protein (CRP) ELISA Kit
SEA821Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 3127.98
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human C Reactive Protein (CRP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human C Reactive Protein (CRP) in serum, plasma, tissue homogenates, cell lysates, urine, cerebrospinal fluid, cell culture supernates and other biological fluids.

Human C Reactive Protein (CRP) ELISA Kit
SEA821Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 345.25
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human C Reactive Protein (CRP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human C Reactive Protein (CRP) in serum, plasma, tissue homogenates, cell lysates, urine, cerebrospinal fluid, cell culture supernates and other biological fluids.

Human C Reactive Protein (CRP) ELISA Kit
SEA821Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 450.35
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human C Reactive Protein (CRP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human C Reactive Protein (CRP) in serum, plasma, tissue homogenates, cell lysates, urine, cerebrospinal fluid, cell culture supernates and other biological fluids.

Human C Reactive Protein (CRP) ELISA Kit
SEA821Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 1726.58
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human C Reactive Protein (CRP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human C Reactive Protein (CRP) in serum, plasma, tissue homogenates, cell lysates, urine, cerebrospinal fluid, cell culture supernates and other biological fluids.

Human C Reactive Protein (CRP) ELISA Kit
4-SEA821Hu	Cloud-Clone	EUR 3178.00 EUR 1677.00 EUR 451.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as C Reactive Protein elisa. Alternative names of the recognized antigen: C-RP PTX1 Pentraxin-Related Pentraxin 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, urine, cerebrospinal fluid, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human C-Reactive Protein/CRP ELISA Kit
RK00078	Abclonal	96 Tests	EUR 521

Human C Reactive Protein (CRP) ELISA Kit
RDR-CRP-Hu-48Tests	Reddot Biotech	48 Tests	EUR 388

Human C Reactive Protein (CRP) ELISA Kit
RDR-CRP-Hu-96Tests	Reddot Biotech	96 Tests	EUR 533

Human C Reactive Protein (CRP) ELISA Kit
RD-CRP-Hu-48Tests	Reddot Biotech	48 Tests	EUR 372

Human C Reactive Protein (CRP) ELISA Kit
RD-CRP-Hu-96Tests	Reddot Biotech	96 Tests	EUR 510

Human C-Reactive Protein(CRP)ELISA Kit
QY-E04998	Qayee Biotechnology	96T	EUR 361

Human C-Reactive Protein (CRP) ELISA Kit
STA-392	Cell Biolabs	96 assays	EUR 676
Description: C-Reactive Protein (CRP), named for its capacity to precipitate the somatic C-polysaccharide of Streptococcus pneumoniae, was the first acute-phase protein to be described and is an exquisitely sensitive systemic marker of inflammation and tissue damage.  CRP belongs to the pentraxin family of calcium dependent ligand-binding plasma proteins.  Human CRP binds with highest affinity to phosphocholine residues, but it also binds to a variety of other autologous and extrinsic ligands, and it aggregates or precipitates the cellular, particulate, or molecular structures bearing these ligands. Cell Biolabs? Human CRP ELISA Kit is an enzyme immunoassay developed for the detection and quantitation of human CRP in plasma, serum or other biological fluid samples.  The kit has detection sensitivity limit of 1 ng/mL human CRP.  Each kit provides sufficient reagents to perform up to 96 assays including standard curve and unknown samples.

Goat Calcium homeostasis modulator protein 1(CALHM1) ELISA kit
E06C1320-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Calcium homeostasis modulator protein 1(CALHM1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Calcium homeostasis modulator protein 1(CALHM1) ELISA kit
E06C1320-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Calcium homeostasis modulator protein 1(CALHM1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human ROMO1(Reactive Oxygen Species Modulator 1) ELISA Package