Human ROMO1(Reactive Oxygen Species Modulator 1) ELISA Package
Human Reactive Oxygen Species Modulator 1 (ROMO1) ELISA Kit |
RDR-ROMO1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 589 |
Human Reactive Oxygen Species Modulator 1 (ROMO1) ELISA Kit |
RDR-ROMO1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 820 |
Mouse Reactive Oxygen Species Modulator 1 (ROMO1) ELISA Kit |
DLR-ROMO1-Mu-48T |
DL Develop |
48T |
EUR 566 |
- Should the Mouse Reactive Oxygen Species Modulator 1 (ROMO1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Reactive Oxygen Species Modulator 1 (ROMO1) in samples from tissue homogenates, cell lysates or other biological fluids. |
Mouse Reactive Oxygen Species Modulator 1 (ROMO1) ELISA Kit |
DLR-ROMO1-Mu-96T |
DL Develop |
96T |
EUR 741 |
- Should the Mouse Reactive Oxygen Species Modulator 1 (ROMO1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Reactive Oxygen Species Modulator 1 (ROMO1) in samples from tissue homogenates, cell lysates or other biological fluids. |
Mouse Reactive Oxygen Species Modulator 1 (ROMO1) ELISA Kit |
RD-ROMO1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 577 |
Mouse Reactive Oxygen Species Modulator 1 (ROMO1) ELISA Kit |
RD-ROMO1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 802 |
Mouse Reactive Oxygen Species Modulator 1 (ROMO1) ELISA Kit |
RDR-ROMO1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 603 |
Mouse Reactive Oxygen Species Modulator 1 (ROMO1) ELISA Kit |
RDR-ROMO1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 840 |
Reactive Oxygen Species Modulator 1 (ROMO1) Antibody |
20-abx174338 |
Abbexa |
|
|
|
Reactive Oxygen Species Modulator 1 (ROMO1) Antibody |
20-abx178215 |
Abbexa |
|
|
|
Reactive Oxygen Species Modulator 1 (ROMO1) Antibody |
abx237383-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Reactive Oxygen Species Modulator 1 (ROMO1) Antibody |
20-abx305165 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Mouse Reactive oxygen species modulator 1 (Romo1) |
1-CSB-CF020063MO |
Cusabio |
-
EUR 1163.00
-
EUR 437.00
-
EUR 693.00
|
|
- MW: 11.0 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Mouse Reactive oxygen species modulator 1(Romo1) expressed in in vitro E.coli expression system |
Human Reactive oxygen species modulator 1 (ROMO1) ELISA Kit |
abx571602-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human ROMO1/ Reactive oxygen species modulator 1 ELISA Kit |
E2168Hu |
Sunlong |
1 Kit |
EUR 571 |
Human ROMO1(Reactive oxygen species modulator 1) ELISA Kit |
EH2003 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 31.2-2000 pg/ml
- Uniprot ID: P60602
- Alias: ROMO1/Reactive oxygen species modulator 1/ROS modulator 1/Protein MGR2 homolog/Mitochondrial targeting GxxxG motif protein/MTGM/Protein MGR2 homolog/Glyrichin
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml |
Human Reactive oxygen species modulator 1, ROMO1 ELISA KIT |
ELI-06179h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Reactive Oxygen Species Modulator 1 (ROMO1) ELISA Kit |
20-abx152978 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Reactive oxygen species modulator 1 (ROMO1) ELISA Kit |
abx251327-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Reactive Oxygen Species Modulator 1 (ROMO1) ELISA Kit |
SEQ510Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5189.65 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reactive Oxygen Species Modulator 1 (ROMO1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reactive Oxygen Species Modulator 1 (ROMO1) in Tissue homogenates, cell lysates and other biological fluids. |
Human Reactive Oxygen Species Modulator 1 (ROMO1) ELISA Kit |
SEQ510Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 515.03 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reactive Oxygen Species Modulator 1 (ROMO1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reactive Oxygen Species Modulator 1 (ROMO1) in Tissue homogenates, cell lysates and other biological fluids. |
Human Reactive Oxygen Species Modulator 1 (ROMO1) ELISA Kit |
SEQ510Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 692.9 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reactive Oxygen Species Modulator 1 (ROMO1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reactive Oxygen Species Modulator 1 (ROMO1) in Tissue homogenates, cell lysates and other biological fluids. |
Human Reactive Oxygen Species Modulator 1 (ROMO1) ELISA Kit |
SEQ510Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2818.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reactive Oxygen Species Modulator 1 (ROMO1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reactive Oxygen Species Modulator 1 (ROMO1) in Tissue homogenates, cell lysates and other biological fluids. |
Human Reactive Oxygen Species Modulator 1 (ROMO1) ELISA Kit |
4-SEQ510Hu |
Cloud-Clone |
-
EUR 5240.00
-
EUR 2769.00
-
EUR 693.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Reactive Oxygen Species Modulator 1 elisa. Alternative names of the recognized antigen: C20orf52
- MTGMP
- Glyrichin
- Mitochondrial Targeting GXXXG Protein
- Epididymis tissue protein Li 175
- Protein MGR2 homolog
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Reactive Oxygen Species Modulator 1 (ROMO1) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Human Reactive Oxygen Species Modulator 1 (ROMO1) Protein |
20-abx654907 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Cow Reactive oxygen species modulator 1 (ROMO1) ELISA Kit |
abx518839-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Pig Reactive oxygen species modulator 1 (ROMO1) ELISA Kit |
abx518842-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Romo1/ Reactive oxygen species modulator 1 ELISA Kit |
E1277Mo |
Sunlong |
1 Kit |
EUR 571 |
Mouse Reactive oxygen species modulator 1, Romo1 ELISA KIT |
ELI-06180m |
Lifescience Market |
96 Tests |
EUR 865 |
Bovine Reactive oxygen species modulator 1, ROMO1 ELISA KIT |
ELI-06181b |
Lifescience Market |
96 Tests |
EUR 928 |
Porcine Reactive oxygen species modulator 1, ROMO1 ELISA KIT |
ELI-06182p |
Lifescience Market |
96 Tests |
EUR 928 |
Rat ROMO1(Reactive oxygen species modulator 1) ELISA Kit |
ER1611 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 15.625-1000 pg/ml
- Alias: Reactive oxygen species modulator 1
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 9.375pg/ml |
Mouse Romo1( Reactive oxygen species modulator 1) ELISA Kit |
EM0699 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 15.6-1000 pg/ml
- Uniprot ID: P60603
- Alias: Romo1/Reactive oxygen species modulator 1/ROS modulator 1/Protein MGR2 homolog/Mitochondrial targeting GxxxG motif protein/MTGM/Protein MGR2 homolog/Glyrichin
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 9.375pg/ml |
Mouse Reactive oxygen species modulator 1 (ROMO1) ELISA Kit |
abx255047-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Rat Reactive Oxygen Species Modulator 1 (ROMO1) ELISA Kit |
abx257722-96tests |
Abbexa |
96 tests |
EUR 652 |
- Shipped within 5-12 working days.
|
Rat Reactive Oxygen Species Modulator 1 (ROMO1) ELISA Kit |
abx391904-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
for Reactive Oxygen Species
Modulator 1 (ROMO1))ELISA kit |
SEQ510Bo-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5647.8 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Reactive Oxygen Species
Modulator 1 (ROMO1)) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Reactive Oxygen Species
Modulator 1 (ROMO1)) in Tissue homogenates, cell lysates and other biological fluids. |
for Reactive Oxygen Species
Modulator 1 (ROMO1))ELISA kit |
SEQ510Bo-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 552.76 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Reactive Oxygen Species
Modulator 1 (ROMO1)) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Reactive Oxygen Species
Modulator 1 (ROMO1)) in Tissue homogenates, cell lysates and other biological fluids. |
for Reactive Oxygen Species
Modulator 1 (ROMO1))ELISA kit |
SEQ510Bo-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 746.8 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Reactive Oxygen Species
Modulator 1 (ROMO1)) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Reactive Oxygen Species
Modulator 1 (ROMO1)) in Tissue homogenates, cell lysates and other biological fluids. |
for Reactive Oxygen Species
Modulator 1 (ROMO1))ELISA kit |
SEQ510Bo-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 3060.6 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Reactive Oxygen Species
Modulator 1 (ROMO1)) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Reactive Oxygen Species
Modulator 1 (ROMO1)) in Tissue homogenates, cell lysates and other biological fluids. |
"ELISA Kit for Reactive Oxygen Species
Modulator 1 (ROMO1)" |
4-SEQ510Bo |
Cloud-Clone |
-
EUR 5698.00
-
EUR 3011.00
-
EUR 747.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Reactive Oxygen Species
Modulator 1 (ROMO1) elisa. Alternative names of the recognized antigen: C20orf52
- MTGMP
- Glyrichin
- Mitochondrial Targeting GXXXG Protein
- Epididymis tissue protein Li 175
- Protein MGR2 homolog
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of "Reactive Oxygen Species
Modulator 1 (ROMO1)" in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Reactive Oxygen Species Modulator 1 (ROMO1) CLIA Kit |
20-abx496194 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Mouse Reactive Oxygen Species Modulator 1 (ROMO1) Protein |
20-abx650868 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Reactive Oxygen Species Modulator 1 (ROMO1) Antibody (HRP) |
20-abx305166 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Reactive Oxygen Species Modulator 1 (ROMO1) Antibody (FITC) |
20-abx305167 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Reactive Oxygen Species Modulator 1 (ROMO1) Antibody (Biotin) |
20-abx305168 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
ELISA kit for Human ROMO1 (Reactive oxygen species modulator 1) |
E-EL-H5430 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's ROMO1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human ROMO1. Standards or samples are added to the micro ELISA plate wells and combined with
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human ROMO1 (Reactive oxygen species modulator 1) in samples from Serum, Plasma, Cell supernatant |
ELISA kit for Human ROMO1 (Reactive Oxygen Species Modulator 1) |
ELK6968 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Reactive Oxygen Species Modulator 1 (ROMO1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody sp
- Show more
|
Description: A sandwich ELISA kit for detection of Reactive Oxygen Species Modulator 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Romo1 ELISA Kit| Mouse Reactive oxygen species modulator 1 ELIS |
EF013312 |
Lifescience Market |
96 Tests |
EUR 689 |
ELISA kit for Rat Reactive oxygen species modulator 1 (ROMO1) |
KTE100977-48T |
Abbkine |
48T |
EUR 332 |
- The main source of ROS is known to be the mitochondria, and increased levels of ROS from the mitochondria have been observed in many cancer cells. Thus far, the mechanism of ROS production in cancer cell proliferation in the mitochondria is not well-
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Reactive oxygen species modulator 1 (ROMO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Reactive oxygen species modulator 1 (ROMO1) |
KTE100977-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- The main source of ROS is known to be the mitochondria, and increased levels of ROS from the mitochondria have been observed in many cancer cells. Thus far, the mechanism of ROS production in cancer cell proliferation in the mitochondria is not well-
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Reactive oxygen species modulator 1 (ROMO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Reactive oxygen species modulator 1 (ROMO1) |
KTE100977-96T |
Abbkine |
96T |
EUR 539 |
- The main source of ROS is known to be the mitochondria, and increased levels of ROS from the mitochondria have been observed in many cancer cells. Thus far, the mechanism of ROS production in cancer cell proliferation in the mitochondria is not well-
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Reactive oxygen species modulator 1 (ROMO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ROMO1 ELISA Kit| Rat Reactive oxygen species modulator 1 ELISA K |
EF018208 |
Lifescience Market |
96 Tests |
EUR 689 |
ELISA kit for Human Reactive oxygen species modulator 1 |
EK4091 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Reactive oxygen species modulator 1 in samples from serum, plasma, tissue homogenates and other biological fluids. |
ELISA kit for Mouse Reactive oxygen species modulator 1 |
EK4090 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Reactive oxygen species modulator 1 in samples from serum, plasma, tissue homogenates and other biological fluids. |
Mouse reactive oxygen species, ROS ELISA Kit |
ELA-E1924m |
Lifescience Market |
96 Tests |
EUR 865 |
Rat reactive oxygen species(ROS)ELISA Kit |
GA-E0312RT-48T |
GenAsia Biotech |
48T |
EUR 317 |
Rat reactive oxygen species(ROS)ELISA Kit |
GA-E0312RT-96T |
GenAsia Biotech |
96T |
EUR 496 |
ELISA kit for Mouse Reactive oxygen species (ROS) |
KTE71621-48T |
Abbkine |
48T |
EUR 354 |
Description: Quantitative sandwich ELISA for measuring Mouse Reactive oxygen species (ROS) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Reactive oxygen species (ROS) |
KTE71621-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
Description: Quantitative sandwich ELISA for measuring Mouse Reactive oxygen species (ROS) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Reactive oxygen species (ROS) |
KTE71621-96T |
Abbkine |
96T |
EUR 572 |
Description: Quantitative sandwich ELISA for measuring Mouse Reactive oxygen species (ROS) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Reactive Oxygen Species (ROS) Detection Assay Kit |
K936-100 |
Biovision |
|
EUR 267 |
Reactive Oxygen Species (ROS) Detection Assay Kit |
K936-250 |
Biovision |
|
EUR 316 |
Human Negative regulator of reactive oxygen species (NRROS) |
1-CSB-EP801264HU |
Cusabio |
-
EUR 611.00
-
EUR 309.00
-
EUR 1827.00
-
EUR 939.00
-
EUR 1218.00
-
EUR 397.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 74.5 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Negative regulator of reactive oxygen species(NRROS),partial expressed in E.coli |
Human Negative regulator of reactive oxygen species (NRROS) |
1-CSB-BP801264HU |
Cusabio |
-
EUR 840.00
-
EUR 332.00
-
EUR 2170.00
-
EUR 1135.00
-
EUR 1579.00
-
EUR 470.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 73.5 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Negative regulator of reactive oxygen species(NRROS),partial expressed in Baculovirus |
Recombinant human Negative regulator of reactive oxygen species |
P1956 |
FN Test |
100ug |
Ask for price |
- Uniprot ID: Q86YC3
- Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
|
Description: Recombinant protein for human Negative regulator of reactive oxygen species |
ROS Brite™ 570 *Optimized for Detecting Reactive Oxygen Species (ROS)* |
16000 |
AAT Bioquest |
1 mg |
EUR 219 |
- R-phrase: R20, R21, R22
- H-Phrase: H303, H313, H333
- Symbol for dangerous compounds: Xn
- UNSPEC Code: 12352200
|
ROS Brite™ 670 *Optimized for Detecting Reactive Oxygen Species (ROS)* |
16002 |
AAT Bioquest |
1 mg |
EUR 219 |
- R-phrase: R20, R21, R22
- H-Phrase: H303, H313, H333
- Symbol for dangerous compounds: Xn
- UNSPEC Code: 12352200
|
ROS Brite™ APF *Optimized for Detecting Reactive Oxygen Species (ROS)* |
16050 |
AAT Bioquest |
1 mg |
EUR 176 |
- R-phrase: R20, R21, R22
- H-Phrase: H303, H313, H333
- Symbol for dangerous compounds: Xn
- UNSPEC Code: 12352200
|
ROS Brite™ HPF *Optimized for Detecting Reactive Oxygen Species (ROS)* |
16051 |
AAT Bioquest |
1 mg |
EUR 176 |
- R-phrase: R20, R21, R22
- H-Phrase: H303, H313, H333
- Symbol for dangerous compounds: Xn
- UNSPEC Code: 12352200
|
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
MitoROS™ 580 *Optimized for Detecting Reactive Oxygen Species (ROS) in Mitochondria* |
16052 |
AAT Bioquest |
500 Tests |
EUR 219 |
- R-phrase: R20, R21, R22
- H-Phrase: H303, H313, H333
- Symbol for dangerous compounds: Xn
- UNSPEC Code: 12352200
|
ELISA kit for Mouse Reactive nitrogen species (RNS) |
KTE71622-48T |
Abbkine |
48T |
EUR 354 |
Description: Quantitative sandwich ELISA for measuring Mouse Reactive nitrogen species (RNS) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Reactive nitrogen species (RNS) |
KTE71622-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
Description: Quantitative sandwich ELISA for measuring Mouse Reactive nitrogen species (RNS) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Reactive nitrogen species (RNS) |
KTE71622-96T |
Abbkine |
96T |
EUR 572 |
Description: Quantitative sandwich ELISA for measuring Mouse Reactive nitrogen species (RNS) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Canine Reactive OXyen Species (ROS) |
KTE20106-48T |
Abbkine |
48T |
EUR 332 |
- Reactive oxygen species (ROS) are chemically reactive chemical species containing oxygen. Examples include peroxides, superoxide, hydroxyl radical, and singlet oxygen. In a biological context, ROS are formed as a natural byproduct of the normal metab
- Show more
|
Description: Quantitative sandwich ELISA for measuring Canine Reactive OXyen Species (ROS) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Canine Reactive OXyen Species (ROS) |
KTE20106-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Reactive oxygen species (ROS) are chemically reactive chemical species containing oxygen. Examples include peroxides, superoxide, hydroxyl radical, and singlet oxygen. In a biological context, ROS are formed as a natural byproduct of the normal metab
- Show more
|
Description: Quantitative sandwich ELISA for measuring Canine Reactive OXyen Species (ROS) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Canine Reactive OXyen Species (ROS) |
KTE20106-96T |
Abbkine |
96T |
EUR 539 |
- Reactive oxygen species (ROS) are chemically reactive chemical species containing oxygen. Examples include peroxides, superoxide, hydroxyl radical, and singlet oxygen. In a biological context, ROS are formed as a natural byproduct of the normal metab
- Show more
|
Description: Quantitative sandwich ELISA for measuring Canine Reactive OXyen Species (ROS) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Human C-Reactive Protein (CRP) AssayMax ELISA Kit |
EC1001-1 |
AssayPro |
96 Well Plate |
EUR 396 |
Human Oxygen- regulated protein 1, RP1 ELISA KIT |
ELI-15342h |
Lifescience Market |
96 Tests |
EUR 824 |
Rat C-Reactive Protein (CRP) AssayMax ELISA Kit |
ERC1001-1 |
AssayPro |
96 Well Plate |
EUR 396 |
Mouse C-Reactive Protein (CRP) AssayMax ELISA Kit |
EMC1001-1 |
AssayPro |
96 Well Plate |
EUR 396 |
?-Amyloid Precursor Protein Modulator |
B7842-1 |
ApexBio |
1 mg |
EUR 284 |
Description: ?-Amyloid Precursor Protein Modulator is a benzolactam derived PKC activator.Protein kinase C (PKC) belongs to a family of protein kinase enzymes involved in phosphorylating serine and threonine of other proteins. |
C-Reactive Protein, Human fluids |
P1441-1 |
Biovision |
|
EUR 185 |
CRP C-Reactive Protein Human |
PROTP02741-1 |
BosterBio |
Regular: 1mg |
EUR 317 |
Description: Human CRP produced in Human plasma having a molecular mass of 114 kDa. ;It can be used as a marker for inflammation and also used for monitoring and prediction of future events in coronary artery disease. |
Human NODAL Modulator 1 (NOMO1) ELISA Kit |
abx381845-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Oxygen- regulated protein 1, Rp1 ELISA KIT |
ELI-21635m |
Lifescience Market |
96 Tests |
EUR 865 |
Bovine Oxygen- regulated protein 1, RP1 ELISA KIT |
ELI-53166b |
Lifescience Market |
96 Tests |
EUR 928 |
Human Modulator of apoptosis 1, MOAP1 ELISA KIT |
ELI-20830h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Modulator of apoptosis 1 (MOAP1) ELISA Kit |
abx385167-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
ROMO1 Antibody |
47598-100ul |
SAB |
100ul |
EUR 252 |
ROMO1 siRNA |
20-abx931845 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ROMO1 siRNA |
20-abx931846 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ROMO1 Antibody |
1-CSB-PA020063LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ROMO1. Recognizes ROMO1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200 |
MAP kinase fragment [Multiple species] |
A1079-1 |
ApexBio |
1 mg |
EUR 108 |
Description: This Mitogen-activated protein kinase (MAP kinase) fragment has a peptide sequence of Lys-Tyr-Ile-His-Ser-Ala-Asn-Val-Leu.The MAP kinases are serine/threonine-specific protein kinasesbelonging to the CMGC (CDK/MAPK/GSK3/CLK) kinase group. |
GPR120 modulator 1 |
A3441-10 |
ApexBio |
10 mg |
EUR 701 |
Description: GPR120 modulator 1 is useful for modulating G protein-coupled receptor 120 (GPR120). |
GPR120 modulator 1 |
A3441-5 |
ApexBio |
5 mg |
EUR 547 |
Description: GPR120 modulator 1 is useful for modulating G protein-coupled receptor 120 (GPR120). |
GPR120 modulator 1 |
A3441-5.1 |
ApexBio |
10 mM (in 1mL DMSO) |
EUR 598 |
Description: GPR120 modulator 1 is useful for modulating G protein-coupled receptor 120 (GPR120). |
GPR120 modulator 1 |
A3441-50 |
ApexBio |
50 mg |
EUR 1805 |
Description: GPR120 modulator 1 is useful for modulating G protein-coupled receptor 120 (GPR120). |
ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody |
EXOAB-KIT-1 |
SBI |
25 ul each |
EUR 627 |
|
mRNAExpress mRNA Synthesis kit (5 reactions) |
MR-KIT-1 |
SBI |
5 reactions |
EUR 1152 |
- Category: Stem Cell Products
|
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN320A-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN340iPS-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
Human Calcium homeostasis modulator protein 1(CALHM1) ELISA kit |
E01C1320-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Calcium homeostasis modulator protein 1(CALHM1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Calcium homeostasis modulator protein 1(CALHM1) ELISA kit |
E01C1320-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Calcium homeostasis modulator protein 1(CALHM1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Calcium homeostasis modulator protein 1(CALHM1) ELISA kit |
E01C1320-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Calcium homeostasis modulator protein 1(CALHM1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Calcium homeostasis modulator protein 1, CALHM1 ELISA KIT |
ELI-11081h |
Lifescience Market |
96 Tests |
EUR 824 |
Human G- protein- signaling modulator 1, GPSM1 ELISA KIT |
ELI-32665h |
Lifescience Market |
96 Tests |
EUR 824 |
Human G-Protein-Signaling Modulator 1 (GPSM1) ELISA Kit |
abx259383-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Calcium Homeostasis Modulator Protein 1 (CALHM1) ELISA Kit |
20-abx386261 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-12 working days.
|
ELISA kit for Human Modulator of apoptosis 1 (MOAP1) |
KTE61574-48T |
Abbkine |
48T |
EUR 332 |
- Modulator of apoptosis 1 encoded by MOAP1 was identified by its interaction with apoptosis regulator BAX protein. This protein contains a Bcl-2 homology 3 (BH3)-like motif, which is required for the association with BAX. When overexpressed, MOAP1 has
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Modulator of apoptosis 1 (MOAP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Modulator of apoptosis 1 (MOAP1) |
KTE61574-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Modulator of apoptosis 1 encoded by MOAP1 was identified by its interaction with apoptosis regulator BAX protein. This protein contains a Bcl-2 homology 3 (BH3)-like motif, which is required for the association with BAX. When overexpressed, MOAP1 has
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Modulator of apoptosis 1 (MOAP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Modulator of apoptosis 1 (MOAP1) |
KTE61574-96T |
Abbkine |
96T |
EUR 539 |
- Modulator of apoptosis 1 encoded by MOAP1 was identified by its interaction with apoptosis regulator BAX protein. This protein contains a Bcl-2 homology 3 (BH3)-like motif, which is required for the association with BAX. When overexpressed, MOAP1 has
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Modulator of apoptosis 1 (MOAP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Human ROMO1 shRNA Plasmid |
20-abx965325 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
ROMO1 Recombinant Protein (Human) |
RP026752 |
ABM |
100 ug |
Ask for price |
eukaryotic translation elongation factor 1 alpha 1 (EEF1A1) (387-394) [Multiple species] |
A1067-1 |
ApexBio |
1 mg |
EUR 108 |
Description: Sequence: LEU-GLU-ASP-GLY-PRO-LYS-PHE-LEUeukaryotic translation elongation factor 1 alpha 1 (EEF1A1) encodes an isoform of the alpha subunit of the elongation factor-1 complex, which is responsible for the enzymatic delivery of aminoacyl tRNAs to the ribosome. |
ferritin heavy chain fragment [Multiple species] |
A1069-1 |
ApexBio |
1 mg |
EUR 108 |
Description: Sequence: H2N-YLNEQVKAI-OHThe two heavy chains are colored red and blue and the two light chains green and yellow.Ferritin is a protein of 450 kDa consisting of 24 subunits that is present in every cell type. |
Multiple Species Frozen Tissue Array - Brain |
T6134035-1 |
Biochain |
1 slide |
EUR 220 |
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool. |
Multiple Species Frozen Tissue Array - Liver |
T6134149-1 |
Biochain |
1 slide |
EUR 220 |
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool. |
Multi-species Stathmin 1 (STMN1) ELISA Kit |
SEC892Mi-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5124.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Multi-species Stathmin 1 (STMN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Multi-species Stathmin 1 (STMN1) in tissue homogenates, cell lysates and other biological fluids. |
Multi-species Stathmin 1 (STMN1) ELISA Kit |
SEC892Mi-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 509.64 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Multi-species Stathmin 1 (STMN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Multi-species Stathmin 1 (STMN1) in tissue homogenates, cell lysates and other biological fluids. |
Multi-species Stathmin 1 (STMN1) ELISA Kit |
SEC892Mi-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 685.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Multi-species Stathmin 1 (STMN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Multi-species Stathmin 1 (STMN1) in tissue homogenates, cell lysates and other biological fluids. |
Multi-species Stathmin 1 (STMN1) ELISA Kit |
SEC892Mi-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2783.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Multi-species Stathmin 1 (STMN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Multi-species Stathmin 1 (STMN1) in tissue homogenates, cell lysates and other biological fluids. |
Multi-species Stathmin 1 (STMN1) ELISA Kit |
4-SEC892Mi |
Cloud-Clone |
-
EUR 5175.00
-
EUR 2734.00
-
EUR 686.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Stathmin 1 elisa. Alternative names of the recognized antigen: LAP18
- C1orf215
- Lag
- OP18
- PP17
- PP19
- PR22
- SMN
- Metablastin
- Prosolin
- Oncoprotein 18
- Leukemia-associated phosphoprotein p18
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Multi-species Stathmin 1 (STMN1) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Anti-C Reactive Protein/Crp Antibody |
A00249-1 |
BosterBio |
100ug/vial |
EUR 334 |
oxygen electrode, s8 |
SZ90Y |
Consort |
ea |
EUR 656 |
Human C Reactive Protein ELISA kit |
E01C0009-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human C Reactive Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human C Reactive Protein ELISA kit |
E01C0009-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human C Reactive Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human C Reactive Protein ELISA kit |
E01C0009-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human C Reactive Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human NODAL Modulator 2 (NOMO2) ELISA Kit |
abx381846-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
ROMO1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1868502 |
ABM |
1.0 ug DNA |
EUR 154 |
Mouse Modulator of apoptosis 1, Moap1 ELISA KIT |
ELI-20831m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Modulator of apoptosis 1 (MOAP1) ELISA Kit |
abx389916-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Moap1 ELISA Kit| Mouse Modulator of apoptosis 1 ELISA Kit |
EF015555 |
Lifescience Market |
96 Tests |
EUR 689 |
Human Small G protein signaling modulator 1, SGSM1 ELISA KIT |
ELI-52960h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Small G protein signaling modulator 1 (SGSM1) ELISA Kit |
abx383162-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human DNA Damage Regulated Autophagy Modulator 1 (DRAM1) ELISA Kit |
abx251626-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
ROMO1 Conjugated Antibody |
C47598 |
SAB |
100ul |
EUR 397 |
ROMO1 cloning plasmid |
CSB-CL020063HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 240
- Sequence: atgccggtggccgtgggtccctacggacagtcccagccaagctgcttcgaccgtgtcaaaatgggcttcgtgatgggttgcgccgtgggcatggcggccggggcgctcttcggcaccttttcctgtctcaggatcggaatgcggggtcgagagctgatgggcggcattgggaaaac
- Show more
|
Description: A cloning plasmid for the ROMO1 gene. |
anti- ROMO1 antibody |
FNab07383 |
FN Test |
100µg |
EUR 585 |
- Immunogen: reactive oxygen species modulator 1
- Uniprot ID: P60602
- Gene ID: 140823
- Research Area: Immunology
|
Description: Antibody raised against ROMO1 |
ROMO1 Polyclonal Antibody |
A60670 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN300A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents) |
CAS510A-KIT |
SBI |
1 Kit |
EUR 805 |
|
CRP C-Reactive Protein Rat Recombinant Protein |
PROTP48199-1 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: CRP produced in Sf9 Insect cells is a single, glycosylated polypeptide chain containing 217 amino acids (20-230 a.a.) and having a molecular mass of 24.1kDa. (Molecular size on SDS-PAGE will appear at approximately 28-40 kDa).;CRP is expressed with a 6 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques. |
PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN400A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
Human NODAL Modulator 1 (NOMO1) Protein |
20-abx650785 |
Abbexa |
-
EUR 634.00
-
EUR 272.00
-
EUR 1901.00
-
EUR 746.00
-
EUR 453.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Modulator of apoptosis 1 (MOAP1) |
1-CSB-EP014693HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 66.5 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Modulator of apoptosis 1(MOAP1) expressed in E.coli |
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN410A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN412A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
ROMO1 ORF Vector (Human) (pORF) |
ORF008918 |
ABM |
1.0 ug DNA |
EUR 95 |
Gpsm1 ELISA Kit| Mouse G-protein-signaling modulator 1 ELISA Kit |
EF014016 |
Lifescience Market |
96 Tests |
EUR 689 |
Human C-Reactive Protein (CRP) ELISA Kit |
abx570001-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human CRP/ C-reactive protein ELISA Kit |
E0562Hu |
Sunlong |
1 Kit |
EUR 451 |
ELISA kit for Human C-reactive protein |
EK2306 |
SAB |
96 tests |
EUR 284 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human C-reactive protein in samples from serum, plasma, tissue homogenates and other biological fluids. |
C-Reactive Protein (CRP) (Human) ELISA Kit |
E4289-100 |
Biovision |
|
EUR 539 |
Human CRP(C-Reactive Protein) ELISA Kit |
EH0099 |
FN Test |
96T |
EUR 476.25 |
- Detection range: 31.2-2000 pg/ml
- Uniprot ID: P02741
- Alias: CRP(C-Reactive Protein)/PTX1/Pentraxin 1
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 2pg/ml |
Human C-Reactive Protein(CRP)ELISA Kit |
GA-E1815HM-48T |
GenAsia Biotech |
48T |
EUR 289 |
Human C-Reactive Protein(CRP)ELISA Kit |
GA-E1815HM-96T |
GenAsia Biotech |
96T |
EUR 466 |
Human C-Reactive Protein (CRP) ELISA Kit |
20-abx150848 |
Abbexa |
-
EUR 5311.00
-
EUR 2837.00
-
EUR 668.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human C Reactive Protein (CRP) ELISA Kit |
20-abx151187 |
Abbexa |
-
EUR 5515.00
-
EUR 2947.00
-
EUR 692.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Ly1 Antibody Reactive (LYAR) ELISA Kit |
abx388353-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human C-Reactive Protein (CRP) ELISA Kit |
abx250236-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human C-Reactive Protein,CRP ELISA Kit |
201-12-1799 |
SunredBio |
96 tests |
EUR 440 |
- This C-Reactive Protein ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human C Reactive Protein (CRP) ELISA Kit |
DLR-CRP-Hu-48T |
DL Develop |
48T |
EUR 385 |
- Should the Human C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, urine, cerebrospinal fluid, cell culture supernates or other biological fluids. |
Human C Reactive Protein (CRP) ELISA Kit |
DLR-CRP-Hu-96T |
DL Develop |
96T |
EUR 492 |
- Should the Human C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, urine, cerebrospinal fluid, cell culture supernates or other biological fluids. |
Human C-Reactive Protein,CRP ELISA Kit |
CN-03290H1 |
ChemNorm |
96T |
EUR 458 |
Human C-Reactive Protein,CRP ELISA Kit |
CN-03290H2 |
ChemNorm |
48T |
EUR 307 |
Human C Reactive Protein (CRP) ELISA Kit |
LF-EK60021 |
Abfrontier |
1×96T |
EUR 679 |
Human C Reactive Protein (CRP) ELISA Kit |
SEA821Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 3127.98 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human C Reactive Protein (CRP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human C Reactive Protein (CRP) in serum, plasma, tissue homogenates, cell lysates, urine, cerebrospinal fluid, cell culture supernates and other biological fluids. |
Human C Reactive Protein (CRP) ELISA Kit |
SEA821Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 345.25 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human C Reactive Protein (CRP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human C Reactive Protein (CRP) in serum, plasma, tissue homogenates, cell lysates, urine, cerebrospinal fluid, cell culture supernates and other biological fluids. |
Human C Reactive Protein (CRP) ELISA Kit |
SEA821Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 450.35 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human C Reactive Protein (CRP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human C Reactive Protein (CRP) in serum, plasma, tissue homogenates, cell lysates, urine, cerebrospinal fluid, cell culture supernates and other biological fluids. |
Human C Reactive Protein (CRP) ELISA Kit |
SEA821Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 1726.58 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human C Reactive Protein (CRP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human C Reactive Protein (CRP) in serum, plasma, tissue homogenates, cell lysates, urine, cerebrospinal fluid, cell culture supernates and other biological fluids. |
Human C Reactive Protein (CRP) ELISA Kit |
4-SEA821Hu |
Cloud-Clone |
-
EUR 3178.00
-
EUR 1677.00
-
EUR 451.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as C Reactive Protein elisa. Alternative names of the recognized antigen: C-RP
- PTX1
- Pentraxin-Related
- Pentraxin 1
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, urine, cerebrospinal fluid, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human C-Reactive Protein/CRP ELISA Kit |
RK00078 |
Abclonal |
96 Tests |
EUR 521 |
Human C Reactive Protein (CRP) ELISA Kit |
RDR-CRP-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 388 |
Human C Reactive Protein (CRP) ELISA Kit |
RDR-CRP-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 533 |
Human C Reactive Protein (CRP) ELISA Kit |
RD-CRP-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 372 |
Human C Reactive Protein (CRP) ELISA Kit |
RD-CRP-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 510 |
Human C-Reactive Protein (CRP) ELISA Kit |
STA-392 |
Cell Biolabs |
96 assays |
EUR 676 |
Description: C-Reactive Protein (CRP), named for its capacity to precipitate the somatic C-polysaccharide of Streptococcus pneumoniae, was the first acute-phase protein to be described and is an exquisitely sensitive systemic marker of inflammation and tissue damage. CRP belongs to the pentraxin family of calcium dependent ligand-binding plasma proteins. Human CRP binds with highest affinity to phosphocholine residues, but it also binds to a variety of other autologous and extrinsic ligands, and it aggregates or precipitates the cellular, particulate, or molecular structures bearing these ligands. Cell Biolabs? Human CRP ELISA Kit is an enzyme immunoassay developed for the detection and quantitation of human CRP in plasma, serum or other biological fluid samples. The kit has detection sensitivity limit of 1 ng/mL human CRP. Each kit provides sufficient reagents to perform up to 96 assays including standard curve and unknown samples. |
Goat Calcium homeostasis modulator protein 1(CALHM1) ELISA kit |
E06C1320-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Calcium homeostasis modulator protein 1(CALHM1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Calcium homeostasis modulator protein 1(CALHM1) ELISA kit |
E06C1320-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Calcium homeostasis modulator protein 1(CALHM1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human ROMO1(Reactive Oxygen Species Modulator 1) ELISA Package