Human EGLN1(Egl 9 Homolog 1) ELISA Package
Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit |
RDR-EGLN1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 603 |
Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit |
RDR-EGLN1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 840 |
Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit |
RD-EGLN1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 577 |
Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit |
RD-EGLN1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 802 |
Egl Nine Homolog 1 (EGLN1) Antibody |
20-abx176226 |
Abbexa |
|
|
|
Egl Nine Homolog 1 (EGLN1) Antibody |
20-abx176227 |
Abbexa |
|
|
|
Egl Nine Homolog 1 (EGLN1) Antibody |
20-abx176228 |
Abbexa |
|
|
|
Egl Nine Homolog 1 (EGLN1) Antibody |
20-abx213651 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Egl Nine Homolog 1 (EGLN1) Antibody |
20-abx112250 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Egl Nine Homolog 1 (EGLN1) Antibody |
20-abx137353 |
Abbexa |
-
EUR 704.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
Egl Nine Homolog 1 (EGLN1) Antibody |
20-abx141591 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 300.00
|
|
- Shipped within 5-10 working days.
|
Egl Nine Homolog 1 (EGLN1) Antibody |
20-abx172198 |
Abbexa |
|
|
|
Egl Nine Homolog 1 (EGLN1) Antibody |
abx030444-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Egl Nine Homolog 1 (EGLN1) Antibody |
abx030444-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Egl Nine Homolog 1 (EGLN1) Antibody |
20-abx241216 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Egl Nine Homolog 1 (EGLN1) Antibody |
20-abx320187 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Egl Nine Homolog 1 (EGLN1) Antibody |
20-abx320188 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Egl Nine Homolog 1 (EGLN1) Antibody |
20-abx322731 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Egl Nine Homolog 1 (EGLN1) Antibody |
20-abx321661 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Egl Nine Homolog 1 (EGLN1) Antibody |
20-abx001065 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Human Egl Nine Homolog 1 (EGLN1)ELISA Kit |
201-12-2501 |
SunredBio |
96 tests |
EUR 440 |
- This Egl Nine Homolog 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Egl Nine Homolog 1 (EGLN1) ELISA Kit |
SEL644Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5189.65 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Egl Nine Homolog 1 (EGLN1) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Egl Nine Homolog 1 (EGLN1) ELISA Kit |
SEL644Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 515.03 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Egl Nine Homolog 1 (EGLN1) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Egl Nine Homolog 1 (EGLN1) ELISA Kit |
SEL644Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 692.9 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Egl Nine Homolog 1 (EGLN1) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Egl Nine Homolog 1 (EGLN1) ELISA Kit |
SEL644Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2818.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Egl Nine Homolog 1 (EGLN1) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Egl Nine Homolog 1 (EGLN1) ELISA Kit |
4-SEL644Hu |
Cloud-Clone |
-
EUR 5240.00
-
EUR 2769.00
-
EUR 693.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Egl Nine Homolog 1 elisa. Alternative names of the recognized antigen: ECYT3
- HIFPH2
- PHD2
- C1orf12
- SM20
- ZMYND6
- HIF Prolyl Hydroxylase 2
- Prolyl hydroxylase domain-containing protein 2
- Hypoxia-inducible factor prolyl hydroxylase 2
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Egl Nine Homolog 1 (EGLN1) in samples from Serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Egl Nine Homolog 1 (EGLN1) Protein |
20-abx653239 |
Abbexa |
-
EUR 620.00
-
EUR 272.00
-
EUR 1859.00
-
EUR 732.00
-
EUR 453.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Rat Egl Nine Homolog 1(EGLN1)ELISA Kit |
GA-E0941RT-48T |
GenAsia Biotech |
48T |
EUR 317 |
Rat Egl Nine Homolog 1(EGLN1)ELISA Kit |
GA-E0941RT-96T |
GenAsia Biotech |
96T |
EUR 496 |
Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit |
SEL644Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5333.64 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Egl Nine Homolog 1 (EGLN1) in Tissue homogenates, cell lysates and other biological fluids. |
Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit |
SEL644Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 526.89 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Egl Nine Homolog 1 (EGLN1) in Tissue homogenates, cell lysates and other biological fluids. |
Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit |
SEL644Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 709.84 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Egl Nine Homolog 1 (EGLN1) in Tissue homogenates, cell lysates and other biological fluids. |
Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit |
SEL644Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2894.28 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Egl Nine Homolog 1 (EGLN1) in Tissue homogenates, cell lysates and other biological fluids. |
Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit |
4-SEL644Mu |
Cloud-Clone |
-
EUR 5384.00
-
EUR 2845.00
-
EUR 710.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Egl Nine Homolog 1 elisa. Alternative names of the recognized antigen: ECYT3
- HIFPH2
- PHD2
- C1orf12
- SM20
- ZMYND6
- HIF Prolyl Hydroxylase 2
- Prolyl hydroxylase domain-containing protein 2
- Hypoxia-inducible factor prolyl hydroxylase 2
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Egl Nine Homolog 1 (EGLN1) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Egl Nine Homolog 1 (EGLN1) CLIA Kit |
20-abx495954 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Human EGLN1 (Egl Nine Homolog 1) |
ELK7299 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Egl Nine Homolog 1 (EGLN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Egl Nin
- Show more
|
Description: A sandwich ELISA kit for detection of Egl Nine Homolog 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human Egl nine homolog 1 (EGLN1) |
KTE61942-48T |
Abbkine |
48T |
EUR 354 |
- EGLN1 catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular ox
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Egl nine homolog 1 (EGLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Egl nine homolog 1 (EGLN1) |
KTE61942-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
- EGLN1 catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular ox
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Egl nine homolog 1 (EGLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Egl nine homolog 1 (EGLN1) |
KTE61942-96T |
Abbkine |
96T |
EUR 572 |
- EGLN1 catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular ox
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Egl nine homolog 1 (EGLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Mouse Egl Nine Homolog 1 (EGLN1) Protein |
20-abx653237 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Mouse Egl Nine Homolog 1 (EGLN1) Protein |
20-abx653238 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Egl nine homolog 1 (EGLN1) polyclonal antibody |
ABP-PAB-11633 |
Allele Biotech |
100 ug |
Ask for price |
- Product line: Miscellaneous
- Brand:
|
Mouse Egl Nine Homolog 1 (EGLN1) CLIA Kit |
20-abx495955 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Mouse EGLN1 (Egl Nine Homolog 1) |
ELK7994 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Egl Nine Homolog 1 (EGLN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Egl Nin
- Show more
|
Description: A sandwich ELISA kit for detection of Egl Nine Homolog 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Mouse Egl nine homolog 1 (EGLN1) |
KTE71217-48T |
Abbkine |
48T |
EUR 332 |
- EGLN1 catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular ox
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Egl nine homolog 1 (EGLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Egl nine homolog 1 (EGLN1) |
KTE71217-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- EGLN1 catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular ox
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Egl nine homolog 1 (EGLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Egl nine homolog 1 (EGLN1) |
KTE71217-96T |
Abbkine |
96T |
EUR 539 |
- EGLN1 catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular ox
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Egl nine homolog 1 (EGLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Human Egl Nine-Like Protein 1 (EGLN1) ELISA Kit |
20-abx151386 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Egl Nine-Like Protein 1 (EGLN1) ELISA Kit |
20-abx153943 |
Abbexa |
-
EUR 7504.00
-
EUR 3996.00
-
EUR 926.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Egl nine homolog 2 Antibody |
20-abx109745 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Egl nine homolog 3 Antibody |
20-abx109746 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Egl Nine Homolog 3 Protein |
20-abx263290 |
Abbexa |
-
EUR 1609.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
Human Egl nine homolog 2 (EGLN2) |
1-CSB-EP007482HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 18.1 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Egl nine homolog 2(EGLN2),partial expressed in E.coli |
Human Egl Nine Homolog 2 (EGLN2) ELISA Kit |
abx259775-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Egl nine homolog 2 Antibody (Biotin) |
20-abx105369 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Egl nine homolog 3 Antibody (Biotin) |
20-abx105370 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Egl nine homolog 2 Antibody (FITC) |
20-abx106788 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Egl nine homolog 3 Antibody (FITC) |
20-abx106789 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Egl nine homolog 2 Antibody (HRP) |
20-abx108207 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Egl nine homolog 3 Antibody (HRP) |
20-abx108208 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Mouse Egl nine homolog 3 protein (Egln3) |
1-CSB-RP147974m |
Cusabio |
-
EUR 505.00
-
EUR 265.00
-
EUR 1827.00
-
EUR 766.00
-
EUR 1218.00
-
EUR 335.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 31.2 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Mouse Egl nine homolog 3 protein(Egln3) expressed in E.coli |
Egl Nine Homolog 2 (C. Elegans) Antibody |
20-abx112251 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Egl Nine Homolog 3 (C. Elegans) Antibody |
20-abx112252 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Egl nine homolog 2 (EGLN2) polyclonal antibody |
ABP-PAB-11634 |
Allele Biotech |
100 ug |
Ask for price |
- Product line: Miscellaneous
- Brand:
|
Egl nine homolog 3 (EGLN3) polyclonal antibody |
ABP-PAB-11635 |
Allele Biotech |
100 ug |
Ask for price |
- Product line: Miscellaneous
- Brand:
|
EGLN3 Egl Nine Homolog 3 Human Recombinant Protein |
PROTQ9H6Z9 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: EGLN3 Human Recombinant produced in E. coli is a single polypeptide chain containing 263 amino acids (1-239) and having a molecular mass of 29.8 kDa.;EGLN3 is fused to a 24 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
Recombinant Human Egl nine homolog 2 Protein, His, E.coli-100ug |
QP5968-ec-100ug |
EnQuireBio |
100ug |
EUR 408 |
Recombinant Human Egl nine homolog 2 Protein, His, E.coli-10ug |
QP5968-ec-10ug |
EnQuireBio |
10ug |
EUR 200 |
Recombinant Human Egl nine homolog 2 Protein, His, E.coli-1mg |
QP5968-ec-1mg |
EnQuireBio |
1mg |
EUR 1632 |
Recombinant Human Egl nine homolog 2 Protein, His, E.coli-200ug |
QP5968-ec-200ug |
EnQuireBio |
200ug |
EUR 634 |
Recombinant Human Egl nine homolog 2 Protein, His, E.coli-500ug |
QP5968-ec-500ug |
EnQuireBio |
500ug |
EUR 1060 |
Recombinant Human Egl nine homolog 2 Protein, His, E.coli-50ug |
QP5968-ec-50ug |
EnQuireBio |
50ug |
EUR 263 |
Recombinant Mouse Egl nine homolog 3 Protein, His, E.coli-100ug |
QP8813-ec-100ug |
EnQuireBio |
100ug |
EUR 571 |
Recombinant Mouse Egl nine homolog 3 Protein, His, E.coli-10ug |
QP8813-ec-10ug |
EnQuireBio |
10ug |
EUR 272 |
Recombinant Mouse Egl nine homolog 3 Protein, His, E.coli-1mg |
QP8813-ec-1mg |
EnQuireBio |
1mg |
EUR 2303 |
Recombinant Mouse Egl nine homolog 3 Protein, His, E.coli-200ug |
QP8813-ec-200ug |
EnQuireBio |
200ug |
EUR 898 |
Recombinant Mouse Egl nine homolog 3 Protein, His, E.coli-500ug |
QP8813-ec-500ug |
EnQuireBio |
500ug |
EUR 1514 |
Recombinant Mouse Egl nine homolog 3 Protein, His, E.coli-50ug |
QP8813-ec-50ug |
EnQuireBio |
50ug |
EUR 362 |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
EGLN1 antibody |
70R-17019 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal EGLN1 antibody |
EGLN1 Antibody |
32185-100ul |
SAB |
100ul |
EUR 252 |
EGLN1 antibody |
10R-1165 |
Fitzgerald |
100 ul |
EUR 316 |
Description: Mouse monoclonal EGLN1 antibody |
EGLN1 Antibody |
42722-100ul |
SAB |
100ul |
EUR 252 |
EGLN1 Antibody |
1-CSB-PA958222 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against EGLN1. Recognizes EGLN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:10-1:50 |
EGLN1 Antibody |
1-CSB-PA863932ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against EGLN1. Recognizes EGLN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
EGLN1 Antibody |
1-CSB-PA863932ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against EGLN1. Recognizes EGLN1 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200 |
EGLN1 Antibody |
DF6285 |
Affbiotech |
200ul |
EUR 304 |
Description: EGLN1 Antibody detects endogenous levels of total EGLN1. |
EGLN1 Antibody |
1-CSB-PA519093 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against EGLN1. Recognizes EGLN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
EGLN1 Antibody |
1-CSB-PA007481GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against EGLN1. Recognizes EGLN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF |
EGLN1 siRNA |
20-abx915075 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EGLN1 siRNA |
20-abx915076 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody |
EXOAB-KIT-1 |
SBI |
25 ul each |
EUR 627 |
|
mRNAExpress mRNA Synthesis kit (5 reactions) |
MR-KIT-1 |
SBI |
5 reactions |
EUR 1152 |
- Category: Stem Cell Products
|
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN320A-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN340iPS-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
Human EGLN1 shRNA Plasmid |
20-abx960144 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
EGLN1 Recombinant Protein (Human) |
RP010303 |
ABM |
100 ug |
Ask for price |
EGLN1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0662402 |
ABM |
1.0 ug DNA |
EUR 154 |
EGLN1 Blocking Peptide |
DF6285-BP |
Affbiotech |
1mg |
EUR 195 |
EGLN1 Polyclonal Antibody |
A-2702 |
EpiGentek |
100 µl |
EUR 483.55 |
Description: fast delivery possible |
EGLN1 / EGLN2 Antibody |
20-abx125802 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
EGLN1 Conjugated Antibody |
C32185 |
SAB |
100ul |
EUR 397 |
Polyclonal EGLN1 Antibody |
APR07662G |
Leading Biology |
0.1mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EGLN1 . This antibody is tested and proven to work in the following applications: |
EGLN1 cloning plasmid |
CSB-CL863932HU-10ug |
Cusabio |
10ug |
EUR 217 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 387
- Sequence: atggttgcttgttatccgggcaatggaacgggttatgtacgtcatgttgataatccaaatggagatggaagatgtgtgacatgtatatattatcttaataaagactgggatgccaaggtaagtggaggtatacttcgaatttttccagaaggcaaagcccagtttgctgacattga
- Show more
|
Description: A cloning plasmid for the EGLN1 gene. |
EGLN1 Rabbit pAb |
A2314-100ul |
Abclonal |
100 ul |
EUR 308 |
EGLN1 Rabbit pAb |
A2314-200ul |
Abclonal |
200 ul |
EUR 459 |
EGLN1 Rabbit pAb |
A2314-20ul |
Abclonal |
20 ul |
EUR 183 |
EGLN1 Rabbit pAb |
A2314-50ul |
Abclonal |
50 ul |
EUR 223 |
anti- EGLN1 antibody |
FNab10184 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: IHC: 1:50-1:500
- Immunogen: Egl nine homolog 1
- Uniprot ID: Q9GZT9
- Gene ID: 54583
|
Description: Antibody raised against EGLN1 |
Anti-EGLN1 antibody |
STJ116175 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular oxygen sensor, and under normal oxygen concentration, modification by prolyl hydroxylation is a key regulatory event that targets HIF subunits for proteasomal destruction via the von Hippel-Lindau ubiquitylation complex. Mutations in this gene are associated with erythrocytosis familial type 3 (ECYT3). |
Anti-EGLN1 antibody |
STJ116768 |
St John's Laboratory |
100 µl |
EUR 413 |
Description: The protein encoded by this gene catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular oxygen sensor, and under normal oxygen concentration, modification by prolyl hydroxylation is a key regulatory event that targets HIF subunits for proteasomal destruction via the von Hippel-Lindau ubiquitylation complex. Mutations in this gene are associated with erythrocytosis familial type 3 (ECYT3). |
Anti-EGLN1 antibody |
STJ23492 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular oxygen sensor, and under normal oxygen concentration, modification by prolyl hydroxylation is a key regulatory event that targets HIF subunits for proteasomal destruction via the von Hippel-Lindau ubiquitylation complex. Mutations in this gene are associated with erythrocytosis familial type 3 (ECYT3). |
PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN300A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents) |
CAS510A-KIT |
SBI |
1 Kit |
EUR 805 |
|
Human Notch Homolog 1 ELISA kit |
E01N0594-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Notch Homolog 1 ELISA kit |
E01N0594-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Notch Homolog 1 ELISA kit |
E01N0594-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Anti-CELSR3/Flamingo Homolog 1 Antibody |
A07204-1 |
BosterBio |
100ul |
EUR 397 |
Description: Rabbit Polyclonal CELSR3/Flamingo Homolog 1 Antibody. Validated in IF and tested in Human, Mouse, Rat. |
Human EGLN1(Egl 9 Homolog 1) ELISA Package