Human EGLN1(Egl Nine Homolog 1) ELISA Kit

Human EGLN1(Egl 9 Homolog 1) ELISA Package

Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit
RDR-EGLN1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 603

Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit
RDR-EGLN1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 840

Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit
RD-EGLN1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 577

Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit
RD-EGLN1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 802

Egl Nine Homolog 1 (EGLN1) Antibody
20-abx176226	Abbexa	EUR 1302.00 EUR 620.00	1 mg 200 ug
Please enquire.

Egl Nine Homolog 1 (EGLN1) Antibody
20-abx176227	Abbexa	EUR 1344.00 EUR 634.00	1 mg 200 ug
Please enquire.

Egl Nine Homolog 1 (EGLN1) Antibody
20-abx176228	Abbexa	EUR 1344.00 EUR 634.00	1 mg 200 ug
Please enquire.

Egl Nine Homolog 1 (EGLN1) Antibody
20-abx213651	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Egl Nine Homolog 1 (EGLN1) Antibody
20-abx112250	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Egl Nine Homolog 1 (EGLN1) Antibody
20-abx137353	Abbexa	EUR 704.00 EUR 328.00 EUR 230.00	100 ug 20 ug 5 ug
Shipped within 5-10 working days.

Egl Nine Homolog 1 (EGLN1) Antibody
20-abx141591	Abbexa	EUR 370.00 EUR 606.00 EUR 300.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Egl Nine Homolog 1 (EGLN1) Antibody
20-abx172198	Abbexa	EUR 926.00 EUR 467.00	1 mg 200 ug
Please enquire.

Egl Nine Homolog 1 (EGLN1) Antibody
abx030444-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Egl Nine Homolog 1 (EGLN1) Antibody
abx030444-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Egl Nine Homolog 1 (EGLN1) Antibody
20-abx241216	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Egl Nine Homolog 1 (EGLN1) Antibody
20-abx320187	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Egl Nine Homolog 1 (EGLN1) Antibody
20-abx320188	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Egl Nine Homolog 1 (EGLN1) Antibody
20-abx322731	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Egl Nine Homolog 1 (EGLN1) Antibody
20-abx321661	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Egl Nine Homolog 1 (EGLN1) Antibody
20-abx001065	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Human Egl Nine Homolog 1 (EGLN1)ELISA Kit
201-12-2501	SunredBio	96 tests	EUR 440
This Egl Nine Homolog 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Egl nine homolog 1, EGLN1 ELISA KIT
ELI-32637h	Lifescience Market	96 Tests	EUR 824

Human Egl Nine Homolog 1(EGLN1)ELISA Kit
QY-E04950	Qayee Biotechnology	96T	EUR 361

Human Egl Nine Homolog 1 (EGLN1) ELISA Kit
SEL644Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5189.65
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Egl Nine Homolog 1 (EGLN1) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Egl Nine Homolog 1 (EGLN1) ELISA Kit
SEL644Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 515.03
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Egl Nine Homolog 1 (EGLN1) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Egl Nine Homolog 1 (EGLN1) ELISA Kit
SEL644Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 692.9
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Egl Nine Homolog 1 (EGLN1) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Egl Nine Homolog 1 (EGLN1) ELISA Kit
SEL644Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2818.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Egl Nine Homolog 1 (EGLN1) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Egl Nine Homolog 1 (EGLN1) ELISA Kit
4-SEL644Hu	Cloud-Clone	EUR 5240.00 EUR 2769.00 EUR 693.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Egl Nine Homolog 1 elisa. Alternative names of the recognized antigen: ECYT3 HIFPH2 PHD2 C1orf12 SM20 ZMYND6 HIF Prolyl Hydroxylase 2 Prolyl hydroxylase domain-containing protein 2 Hypoxia-inducible factor prolyl hydroxylase 2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Egl Nine Homolog 1 (EGLN1) in samples from Serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Egl Nine Homolog 1 (EGLN1) Protein
20-abx653239	Abbexa	EUR 620.00 EUR 272.00 EUR 1859.00 EUR 732.00 EUR 453.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Rat Egl Nine Homolog 1(EGLN1)ELISA Kit
GA-E0941RT-48T	GenAsia Biotech	48T	EUR 317

Rat Egl Nine Homolog 1(EGLN1)ELISA Kit
GA-E0941RT-96T	GenAsia Biotech	96T	EUR 496

Mouse Egl nine homolog 1, Egln1 ELISA KIT
ELI-32638m	Lifescience Market	96 Tests	EUR 865

Rat Egl Nine Homolog 1(EGLN1)ELISA Kit
QY-E10711	Qayee Biotechnology	96T	EUR 361

Mouse Egl Nine Homolog 1(EGLN1)ELISA Kit
QY-E20507	Qayee Biotechnology	96T	EUR 361

Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit
SEL644Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5333.64
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Egl Nine Homolog 1 (EGLN1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit
SEL644Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 526.89
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Egl Nine Homolog 1 (EGLN1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit
SEL644Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 709.84
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Egl Nine Homolog 1 (EGLN1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit
SEL644Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2894.28
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Egl Nine Homolog 1 (EGLN1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit
4-SEL644Mu	Cloud-Clone	EUR 5384.00 EUR 2845.00 EUR 710.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Egl Nine Homolog 1 elisa. Alternative names of the recognized antigen: ECYT3 HIFPH2 PHD2 C1orf12 SM20 ZMYND6 HIF Prolyl Hydroxylase 2 Prolyl hydroxylase domain-containing protein 2 Hypoxia-inducible factor prolyl hydroxylase 2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Egl Nine Homolog 1 (EGLN1) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Egl Nine Homolog 1 (EGLN1) CLIA Kit
20-abx495954	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human EGLN1 (Egl Nine Homolog 1)
ELK7299	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Egl Nine Homolog 1 (EGLN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Egl Nin Show more
Description: A sandwich ELISA kit for detection of Egl Nine Homolog 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Egl nine homolog 1 (EGLN1)
KTE61942-48T	Abbkine	48T	EUR 354
EGLN1 catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular ox Show more
Description: Quantitative sandwich ELISA for measuring Human Egl nine homolog 1 (EGLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Egl nine homolog 1 (EGLN1)
KTE61942-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
EGLN1 catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular ox Show more
Description: Quantitative sandwich ELISA for measuring Human Egl nine homolog 1 (EGLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Egl nine homolog 1 (EGLN1)
KTE61942-96T	Abbkine	96T	EUR 572
EGLN1 catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular ox Show more
Description: Quantitative sandwich ELISA for measuring Human Egl nine homolog 1 (EGLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mouse Egl Nine Homolog 1 (EGLN1) Protein
20-abx653237	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Mouse Egl Nine Homolog 1 (EGLN1) Protein
20-abx653238	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Egl nine homolog 1 (EGLN1) polyclonal antibody
ABP-PAB-11633	Allele Biotech	100 ug	Ask for price
Product line: Miscellaneous Brand:

Mouse Egl Nine Homolog 1 (EGLN1) CLIA Kit
20-abx495955	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Mouse EGLN1 (Egl Nine Homolog 1)
ELK7994	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Egl Nine Homolog 1 (EGLN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Egl Nin Show more
Description: A sandwich ELISA kit for detection of Egl Nine Homolog 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse Egl nine homolog 1 (EGLN1)
KTE71217-48T	Abbkine	48T	EUR 332
EGLN1 catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular ox Show more
Description: Quantitative sandwich ELISA for measuring Mouse Egl nine homolog 1 (EGLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Egl nine homolog 1 (EGLN1)
KTE71217-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
EGLN1 catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular ox Show more
Description: Quantitative sandwich ELISA for measuring Mouse Egl nine homolog 1 (EGLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Egl nine homolog 1 (EGLN1)
KTE71217-96T	Abbkine	96T	EUR 539
EGLN1 catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular ox Show more
Description: Quantitative sandwich ELISA for measuring Mouse Egl nine homolog 1 (EGLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Egl Nine-Like Protein 1 (EGLN1) ELISA Kit
20-abx151386	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Egl Nine-Like Protein 1 (EGLN1) ELISA Kit
20-abx153943	Abbexa	EUR 7504.00 EUR 3996.00 EUR 926.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Egl nine homolog 2 Antibody
20-abx109745	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Egl nine homolog 3 Antibody
20-abx109746	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Egl Nine Homolog 3 Protein
20-abx263290	Abbexa	EUR 1609.00 EUR 328.00 EUR 230.00	100 ug 10 ug 2 µg
Shipped within 5-10 working days.

Human Egl nine homolog 2 (EGLN2)
1-CSB-EP007482HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 18.1 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Egl nine homolog 2(EGLN2),partial expressed in E.coli

Human Egl Nine Homolog 2 (EGLN2) ELISA Kit
abx259775-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Egl nine homolog 2, EGLN2 ELISA KIT
ELI-26924h	Lifescience Market	96 Tests	EUR 824

Human Egl nine homolog 3, EGLN3 ELISA KIT
ELI-47060h	Lifescience Market	96 Tests	EUR 824

Mouse Egl nine homolog 2, Egln2 ELISA KIT
ELI-09617m	Lifescience Market	96 Tests	EUR 865

Mouse Egl nine homolog 3, Egln3 ELISA KIT
ELI-08646m	Lifescience Market	96 Tests	EUR 865

Egl nine homolog 2 Antibody (Biotin)
20-abx105369	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Egl nine homolog 3 Antibody (Biotin)
20-abx105370	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Egl nine homolog 2 Antibody (FITC)
20-abx106788	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Egl nine homolog 3 Antibody (FITC)
20-abx106789	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Egl nine homolog 2 Antibody (HRP)
20-abx108207	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Egl nine homolog 3 Antibody (HRP)
20-abx108208	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Mouse Egl nine homolog 3 protein (Egln3)
1-CSB-RP147974m	Cusabio	EUR 505.00 EUR 265.00 EUR 1827.00 EUR 766.00 EUR 1218.00 EUR 335.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 31.2 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Egl nine homolog 3 protein(Egln3) expressed in E.coli

Egl Nine Homolog 2 (C. Elegans) Antibody
20-abx112251	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Egl Nine Homolog 3 (C. Elegans) Antibody
20-abx112252	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Egl nine homolog 2 (EGLN2) polyclonal antibody
ABP-PAB-11634	Allele Biotech	100 ug	Ask for price
Product line: Miscellaneous Brand:

Egl nine homolog 3 (EGLN3) polyclonal antibody
ABP-PAB-11635	Allele Biotech	100 ug	Ask for price
Product line: Miscellaneous Brand:

EGLN3 Egl Nine Homolog 3 Human Recombinant Protein
PROTQ9H6Z9	BosterBio	Regular: 10ug	EUR 317
Description: EGLN3 Human Recombinant produced in E. coli is a single polypeptide chain containing 263 amino acids (1-239) and having a molecular mass of 29.8 kDa.;EGLN3 is fused to a 24 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Recombinant Human Egl nine homolog 2 Protein, His, E.coli-100ug
QP5968-ec-100ug	EnQuireBio	100ug	EUR 408

Recombinant Human Egl nine homolog 2 Protein, His, E.coli-10ug
QP5968-ec-10ug	EnQuireBio	10ug	EUR 200

Recombinant Human Egl nine homolog 2 Protein, His, E.coli-1mg
QP5968-ec-1mg	EnQuireBio	1mg	EUR 1632

Recombinant Human Egl nine homolog 2 Protein, His, E.coli-200ug
QP5968-ec-200ug	EnQuireBio	200ug	EUR 634

Recombinant Human Egl nine homolog 2 Protein, His, E.coli-500ug
QP5968-ec-500ug	EnQuireBio	500ug	EUR 1060

Recombinant Human Egl nine homolog 2 Protein, His, E.coli-50ug
QP5968-ec-50ug	EnQuireBio	50ug	EUR 263

Recombinant Mouse Egl nine homolog 3 Protein, His, E.coli-100ug
QP8813-ec-100ug	EnQuireBio	100ug	EUR 571

Recombinant Mouse Egl nine homolog 3 Protein, His, E.coli-10ug
QP8813-ec-10ug	EnQuireBio	10ug	EUR 272

Recombinant Mouse Egl nine homolog 3 Protein, His, E.coli-1mg
QP8813-ec-1mg	EnQuireBio	1mg	EUR 2303

Recombinant Mouse Egl nine homolog 3 Protein, His, E.coli-200ug
QP8813-ec-200ug	EnQuireBio	200ug	EUR 898

Recombinant Mouse Egl nine homolog 3 Protein, His, E.coli-500ug
QP8813-ec-500ug	EnQuireBio	500ug	EUR 1514

Recombinant Mouse Egl nine homolog 3 Protein, His, E.coli-50ug
QP8813-ec-50ug	EnQuireBio	50ug	EUR 362

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Egln1/ Rat Egln1 ELISA Kit
ELI-09616r	Lifescience Market	96 Tests	EUR 886

EGLN1 ELISA Kit (Human) (OKCD02054)
OKCD02054	Aviva Systems Biology	96 Wells	EUR 909
Description: Description of target: Cellular oxygen sensor that catalyzes, under normoxic conditions, the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. Hydroxylates a specific proline found in each of the oxygen-dependent degradation (ODD) domains (N-terminal, NODD, and C-terminal, CODD) of HIF1A. Also hydroxylates HIF2A. Has a preference for the CODD site for both HIF1A and HIF1B. Hydroxylated HIFs are then targeted for proteasomal degradation via the von Hippel-Lindau ubiquitination complex. Under hypoxic conditions, the hydroxylation reaction is attenuated allowing HIFs to escape degradation resulting in their translocation to the nucleus, heterodimerization with HIF1B, and increased expression of hypoxy-inducible genes. EGLN1 is the most important isozyme under normoxia and, through regulating the stability of HIF1, involved in various hypoxia-influenced processes such as angiogenesis in retinal and cardiac functionality. Target proteins are preferentially recognized via a LXXLAP motif.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 12.2 pg/mL

EGLN1 ELISA Kit (Human) (OKCA02095)
OKCA02095	Aviva Systems Biology	96 Wells	EUR 917
Description: Description of target: Cellular oxygen sensor that catalyzes, under normoxic conditions, the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. Hydroxylates a specific proline found in each of the oxygen-dependent degradation (ODD) domains (N-terminal, NODD, and C-terminal, CODD) of HIF1A. Also hydroxylates HIF2A. Has a preference for the CODD site for both HIF1A and HIF1B. Hydroxylated HIFs are then targeted for proteasomal degradation via the von Hippel-Lindau ubiquitination complex. Under hypoxic conditions, the hydroxylation reaction is attenuated allowing HIFs to escape degradation resulting in their translocation to the nucleus, heterodimerization with HIF1B, and increased expression of hypoxy-inducible genes. EGLN1 is the most important isozyme under normoxia and, through regulating the stability of HIF1, involved in various hypoxia-influenced processes such as angiogenesis in retinal and cardiac functionality. Target proteins are preferentially recognized via a LXXLAP motif.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7.8 pg/mL

Egln1 ELISA Kit (Mouse) (OKCD02055)
OKCD02055	Aviva Systems Biology	96 Wells	EUR 936
Description: Description of target: Cellular oxygen sensor that catalyzes, under normoxic conditions, the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. Hydroxylates a specific proline found in each of the oxygen-dependent degradation (ODD) domains (N-terminal, NODD, and C-terminal, CODD) of HIF1A. Also hydroxylates HIF2A. Has a preference for the CODD site for both HIF1A and HIF1B. Hydroxylated HIFs are then targeted for proteasomal degradation via the von Hippel-Lindau ubiquitination complex. Under hypoxic conditions, the hydroxylation reaction is attenuated allowing HIFs to escape degradation resulting in their translocation to the nucleus, heterodimerization with HIF1B, and increased expression of hypoxy-inducible genes. EGLN1 is the most important isozyme under normoxia and, through regulating the stability of HIF1, involved in various hypoxia-influenced processes such as angiogenesis in retinal and cardiac functionality. Target proteins are preferentially recognized via a LXXLAP motif.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.116 ng/mL

EGLN1 antibody
70R-17019	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal EGLN1 antibody

EGLN1 Antibody
32185-100ul	SAB	100ul	EUR 252

EGLN1 antibody
10R-1165	Fitzgerald	100 ul	EUR 316
Description: Mouse monoclonal EGLN1 antibody

EGLN1 Antibody
6151-100	Biovision		EUR 414

EGLN1 Antibody
42722-100ul	SAB	100ul	EUR 252

EGLN1 Antibody
1-CSB-PA958222	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EGLN1. Recognizes EGLN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:10-1:50

EGLN1 Antibody
1-CSB-PA863932ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against EGLN1. Recognizes EGLN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

EGLN1 Antibody
1-CSB-PA863932ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against EGLN1. Recognizes EGLN1 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

EGLN1 Antibody
DF6285	Affbiotech	200ul	EUR 304
Description: EGLN1 Antibody detects endogenous levels of total EGLN1.

EGLN1 Antibody
1-CSB-PA519093	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EGLN1. Recognizes EGLN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

EGLN1 Antibody
1-CSB-PA007481GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against EGLN1. Recognizes EGLN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

EGLN1 siRNA
20-abx915075	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

EGLN1 siRNA
20-abx915076	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

EGLN1 Antibody
ABD6285	Lifescience Market	100 ug	EUR 438

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1	SBI	25 ul each	EUR 627
Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1	SBI	5 reactions	EUR 1152
Category: Stem Cell Products

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

Human EGLN1 shRNA Plasmid
20-abx960144	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

EGLN1 Recombinant Protein (Human)
RP010303	ABM	100 ug	Ask for price

EGLN1 sgRNA CRISPR Lentivector (Human) (Target 1)
K0662402	ABM	1.0 ug DNA	EUR 154

EGLN1 Blocking Peptide
DF6285-BP	Affbiotech	1mg	EUR 195

EGLN1 Polyclonal Antibody
A-2702	EpiGentek	100 µl	EUR 483.55
Description: fast delivery possible

EGLN1 / EGLN2 Antibody
20-abx125802	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

EGLN1 Conjugated Antibody
C32185	SAB	100ul	EUR 397

Polyclonal EGLN1 Antibody
APR07662G	Leading Biology	0.1mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EGLN1 . This antibody is tested and proven to work in the following applications:

EGLN1 cloning plasmid
CSB-CL863932HU-10ug	Cusabio	10ug	EUR 217
Formulation: 10 μg plasmid + 200μl Glycerol Length: 387 Sequence: atggttgcttgttatccgggcaatggaacgggttatgtacgtcatgttgataatccaaatggagatggaagatgtgtgacatgtatatattatcttaataaagactgggatgccaaggtaagtggaggtatacttcgaatttttccagaaggcaaagcccagtttgctgacattga Show more
Description: A cloning plasmid for the EGLN1 gene.

EGLN1 Rabbit pAb
A2314-100ul	Abclonal	100 ul	EUR 308

EGLN1 Rabbit pAb
A2314-200ul	Abclonal	200 ul	EUR 459

EGLN1 Rabbit pAb
A2314-20ul	Abclonal	20 ul	EUR 183

EGLN1 Rabbit pAb
A2314-50ul	Abclonal	50 ul	EUR 223

anti- EGLN1 antibody
FNab10184	FN Test	100µg	EUR 505.25
Recommended dilution: IHC: 1:50-1:500 Immunogen: Egl nine homolog 1 Uniprot ID: Q9GZT9 Gene ID: 54583
Description: Antibody raised against EGLN1

Anti-EGLN1 antibody
STJ116175	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular oxygen sensor, and under normal oxygen concentration, modification by prolyl hydroxylation is a key regulatory event that targets HIF subunits for proteasomal destruction via the von Hippel-Lindau ubiquitylation complex. Mutations in this gene are associated with erythrocytosis familial type 3 (ECYT3).

Anti-EGLN1 antibody
STJ116768	St John's Laboratory	100 µl	EUR 413
Description: The protein encoded by this gene catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular oxygen sensor, and under normal oxygen concentration, modification by prolyl hydroxylation is a key regulatory event that targets HIF subunits for proteasomal destruction via the von Hippel-Lindau ubiquitylation complex. Mutations in this gene are associated with erythrocytosis familial type 3 (ECYT3).

Anti-EGLN1 antibody
STJ23492	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular oxygen sensor, and under normal oxygen concentration, modification by prolyl hydroxylation is a key regulatory event that targets HIF subunits for proteasomal destruction via the von Hippel-Lindau ubiquitylation complex. Mutations in this gene are associated with erythrocytosis familial type 3 (ECYT3).

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

Anti-CELSR3/Flamingo Homolog 1 Antibody
A07204-1	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal CELSR3/Flamingo Homolog 1 Antibody. Validated in IF and tested in Human, Mouse, Rat.

Human EGLN1(Egl 9 Homolog 1) ELISA Package