Human EGLN1(Egl Nine Homolog 1) ELISA Kit

Human EGLN1(Egl 9 Homolog 1) ELISA Package

Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit

RDR-EGLN1-Mu-48Tests 48 Tests
EUR 603

Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit

RDR-EGLN1-Mu-96Tests 96 Tests
EUR 840

Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit

RD-EGLN1-Mu-48Tests 48 Tests
EUR 577

Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit

RD-EGLN1-Mu-96Tests 96 Tests
EUR 802

Egl Nine Homolog 1 (EGLN1) Antibody

20-abx176226
  • EUR 1302.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Egl Nine Homolog 1 (EGLN1) Antibody

20-abx176227
  • EUR 1344.00
  • EUR 634.00
  • 1 mg
  • 200 ug
  • Please enquire.

Egl Nine Homolog 1 (EGLN1) Antibody

20-abx176228
  • EUR 1344.00
  • EUR 634.00
  • 1 mg
  • 200 ug
  • Please enquire.

Egl Nine Homolog 1 (EGLN1) Antibody

20-abx213651
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Egl Nine Homolog 1 (EGLN1) Antibody

20-abx112250
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Egl Nine Homolog 1 (EGLN1) Antibody

20-abx137353
  • EUR 704.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Egl Nine Homolog 1 (EGLN1) Antibody

20-abx141591
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Egl Nine Homolog 1 (EGLN1) Antibody

20-abx172198
  • EUR 926.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Egl Nine Homolog 1 (EGLN1) Antibody

abx030444-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Egl Nine Homolog 1 (EGLN1) Antibody

abx030444-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Egl Nine Homolog 1 (EGLN1) Antibody

20-abx241216
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Egl Nine Homolog 1 (EGLN1) Antibody

20-abx320187
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Egl Nine Homolog 1 (EGLN1) Antibody

20-abx320188
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Egl Nine Homolog 1 (EGLN1) Antibody

20-abx322731
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Egl Nine Homolog 1 (EGLN1) Antibody

20-abx321661
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Egl Nine Homolog 1 (EGLN1) Antibody

20-abx001065
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human Egl Nine Homolog 1 (EGLN1)ELISA Kit

201-12-2501 96 tests
EUR 440
  • This Egl Nine Homolog 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Egl nine homolog 1, EGLN1 ELISA KIT

ELI-32637h 96 Tests
EUR 824

Human Egl Nine Homolog 1(EGLN1)ELISA Kit

QY-E04950 96T
EUR 361

Human Egl Nine Homolog 1 (EGLN1) ELISA Kit

SEL644Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Egl Nine Homolog 1 (EGLN1) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Egl Nine Homolog 1 (EGLN1) ELISA Kit

SEL644Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Egl Nine Homolog 1 (EGLN1) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Egl Nine Homolog 1 (EGLN1) ELISA Kit

SEL644Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Egl Nine Homolog 1 (EGLN1) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Egl Nine Homolog 1 (EGLN1) ELISA Kit

SEL644Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Egl Nine Homolog 1 (EGLN1) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Egl Nine Homolog 1 (EGLN1) ELISA Kit

4-SEL644Hu
  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Egl Nine Homolog 1 elisa. Alternative names of the recognized antigen: ECYT3
  • HIFPH2
  • PHD2
  • C1orf12
  • SM20
  • ZMYND6
  • HIF Prolyl Hydroxylase 2
  • Prolyl hydroxylase domain-containing protein 2
  • Hypoxia-inducible factor prolyl hydroxylase 2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Egl Nine Homolog 1 (EGLN1) in samples from Serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Egl Nine Homolog 1 (EGLN1) Protein

20-abx653239
  • EUR 620.00
  • EUR 272.00
  • EUR 1859.00
  • EUR 732.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Rat Egl Nine Homolog 1(EGLN1)ELISA Kit

GA-E0941RT-48T 48T
EUR 317

Rat Egl Nine Homolog 1(EGLN1)ELISA Kit

GA-E0941RT-96T 96T
EUR 496

Mouse Egl nine homolog 1, Egln1 ELISA KIT

ELI-32638m 96 Tests
EUR 865

Rat Egl Nine Homolog 1(EGLN1)ELISA Kit

QY-E10711 96T
EUR 361

Mouse Egl Nine Homolog 1(EGLN1)ELISA Kit

QY-E20507 96T
EUR 361

Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit

SEL644Mu-10x96wellstestplate 10x96-wells test plate
EUR 5333.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Egl Nine Homolog 1 (EGLN1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit

SEL644Mu-1x48wellstestplate 1x48-wells test plate
EUR 526.89
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Egl Nine Homolog 1 (EGLN1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit

SEL644Mu-1x96wellstestplate 1x96-wells test plate
EUR 709.84
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Egl Nine Homolog 1 (EGLN1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit

SEL644Mu-5x96wellstestplate 5x96-wells test plate
EUR 2894.28
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Egl Nine Homolog 1 (EGLN1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit

4-SEL644Mu
  • EUR 5384.00
  • EUR 2845.00
  • EUR 710.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Egl Nine Homolog 1 elisa. Alternative names of the recognized antigen: ECYT3
  • HIFPH2
  • PHD2
  • C1orf12
  • SM20
  • ZMYND6
  • HIF Prolyl Hydroxylase 2
  • Prolyl hydroxylase domain-containing protein 2
  • Hypoxia-inducible factor prolyl hydroxylase 2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Egl Nine Homolog 1 (EGLN1) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Egl Nine Homolog 1 (EGLN1) CLIA Kit

20-abx495954
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human EGLN1 (Egl Nine Homolog 1)

ELK7299 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Egl Nine Homolog 1 (EGLN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Egl Nin
  • Show more
Description: A sandwich ELISA kit for detection of Egl Nine Homolog 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Egl nine homolog 1 (EGLN1)

KTE61942-48T 48T
EUR 354
  • EGLN1 catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular ox
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Egl nine homolog 1 (EGLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Egl nine homolog 1 (EGLN1)

KTE61942-5platesof96wells 5 plates of 96 wells
EUR 2252
  • EGLN1 catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular ox
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Egl nine homolog 1 (EGLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Egl nine homolog 1 (EGLN1)

KTE61942-96T 96T
EUR 572
  • EGLN1 catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular ox
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Egl nine homolog 1 (EGLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mouse Egl Nine Homolog 1 (EGLN1) Protein

20-abx653237
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mouse Egl Nine Homolog 1 (EGLN1) Protein

20-abx653238
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Egl nine homolog 1 (EGLN1) polyclonal antibody

ABP-PAB-11633 100 ug Ask for price
    • Product line: Miscellaneous
    • Brand:

Mouse Egl Nine Homolog 1 (EGLN1) CLIA Kit

20-abx495955
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Mouse EGLN1 (Egl Nine Homolog 1)

ELK7994 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Egl Nine Homolog 1 (EGLN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Egl Nin
  • Show more
Description: A sandwich ELISA kit for detection of Egl Nine Homolog 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse Egl nine homolog 1 (EGLN1)

KTE71217-48T 48T
EUR 332
  • EGLN1 catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular ox
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Egl nine homolog 1 (EGLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Egl nine homolog 1 (EGLN1)

KTE71217-5platesof96wells 5 plates of 96 wells
EUR 2115
  • EGLN1 catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular ox
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Egl nine homolog 1 (EGLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Egl nine homolog 1 (EGLN1)

KTE71217-96T 96T
EUR 539
  • EGLN1 catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular ox
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Egl nine homolog 1 (EGLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Egl Nine-Like Protein 1 (EGLN1) ELISA Kit

20-abx151386
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Egl Nine-Like Protein 1 (EGLN1) ELISA Kit

20-abx153943
  • EUR 7504.00
  • EUR 3996.00
  • EUR 926.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Egl nine homolog 2 Antibody

20-abx109745
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Egl nine homolog 3 Antibody

20-abx109746
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Egl Nine Homolog 3 Protein

20-abx263290
  • EUR 1609.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 10 ug
  • 2 µg
  • Shipped within 5-10 working days.

Human Egl nine homolog 2 (EGLN2)

1-CSB-EP007482HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 18.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Egl nine homolog 2(EGLN2),partial expressed in E.coli

Human Egl Nine Homolog 2 (EGLN2) ELISA Kit

abx259775-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Egl nine homolog 2, EGLN2 ELISA KIT

ELI-26924h 96 Tests
EUR 824

Human Egl nine homolog 3, EGLN3 ELISA KIT

ELI-47060h 96 Tests
EUR 824

Mouse Egl nine homolog 2, Egln2 ELISA KIT

ELI-09617m 96 Tests
EUR 865

Mouse Egl nine homolog 3, Egln3 ELISA KIT

ELI-08646m 96 Tests
EUR 865

Egl nine homolog 2 Antibody (Biotin)

20-abx105369
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Egl nine homolog 3 Antibody (Biotin)

20-abx105370
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Egl nine homolog 2 Antibody (FITC)

20-abx106788
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Egl nine homolog 3 Antibody (FITC)

20-abx106789
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Egl nine homolog 2 Antibody (HRP)

20-abx108207
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Egl nine homolog 3 Antibody (HRP)

20-abx108208
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mouse Egl nine homolog 3 protein (Egln3)

1-CSB-RP147974m
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 31.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Egl nine homolog 3 protein(Egln3) expressed in E.coli

Egl Nine Homolog 2 (C. Elegans) Antibody

20-abx112251
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Egl Nine Homolog 3 (C. Elegans) Antibody

20-abx112252
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Egl nine homolog 2 (EGLN2) polyclonal antibody

ABP-PAB-11634 100 ug Ask for price
    • Product line: Miscellaneous
    • Brand:

Egl nine homolog 3 (EGLN3) polyclonal antibody

ABP-PAB-11635 100 ug Ask for price
    • Product line: Miscellaneous
    • Brand:

EGLN3 Egl Nine Homolog 3 Human Recombinant Protein

PROTQ9H6Z9 Regular: 10ug
EUR 317
Description: EGLN3 Human Recombinant produced in E. coli is a single polypeptide chain containing 263 amino acids (1-239) and having a molecular mass of 29.8 kDa.;EGLN3 is fused to a 24 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Recombinant Human Egl nine homolog 2 Protein, His, E.coli-100ug

QP5968-ec-100ug 100ug
EUR 408

Recombinant Human Egl nine homolog 2 Protein, His, E.coli-10ug

QP5968-ec-10ug 10ug
EUR 200

Recombinant Human Egl nine homolog 2 Protein, His, E.coli-1mg

QP5968-ec-1mg 1mg
EUR 1632

Recombinant Human Egl nine homolog 2 Protein, His, E.coli-200ug

QP5968-ec-200ug 200ug
EUR 634

Recombinant Human Egl nine homolog 2 Protein, His, E.coli-500ug

QP5968-ec-500ug 500ug
EUR 1060

Recombinant Human Egl nine homolog 2 Protein, His, E.coli-50ug

QP5968-ec-50ug 50ug
EUR 263

Recombinant Mouse Egl nine homolog 3 Protein, His, E.coli-100ug

QP8813-ec-100ug 100ug
EUR 571

Recombinant Mouse Egl nine homolog 3 Protein, His, E.coli-10ug

QP8813-ec-10ug 10ug
EUR 272

Recombinant Mouse Egl nine homolog 3 Protein, His, E.coli-1mg

QP8813-ec-1mg 1mg
EUR 2303

Recombinant Mouse Egl nine homolog 3 Protein, His, E.coli-200ug

QP8813-ec-200ug 200ug
EUR 898

Recombinant Mouse Egl nine homolog 3 Protein, His, E.coli-500ug

QP8813-ec-500ug 500ug
EUR 1514

Recombinant Mouse Egl nine homolog 3 Protein, His, E.coli-50ug

QP8813-ec-50ug 50ug
EUR 362

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Egln1/ Rat Egln1 ELISA Kit

ELI-09616r 96 Tests
EUR 886

EGLN1 antibody

70R-17019 50 ul
EUR 435
Description: Rabbit polyclonal EGLN1 antibody

EGLN1 Antibody

32185-100ul 100ul
EUR 252

EGLN1 antibody

10R-1165 100 ul
EUR 316
Description: Mouse monoclonal EGLN1 antibody

EGLN1 Antibody

6151-100
EUR 414

EGLN1 Antibody

42722-100ul 100ul
EUR 252

EGLN1 Antibody

1-CSB-PA958222
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EGLN1. Recognizes EGLN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:10-1:50

EGLN1 Antibody

1-CSB-PA863932ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against EGLN1. Recognizes EGLN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

EGLN1 Antibody

1-CSB-PA863932ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against EGLN1. Recognizes EGLN1 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

EGLN1 Antibody

DF6285 200ul
EUR 304
Description: EGLN1 Antibody detects endogenous levels of total EGLN1.

EGLN1 Antibody

1-CSB-PA519093
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EGLN1. Recognizes EGLN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

EGLN1 Antibody

1-CSB-PA007481GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against EGLN1. Recognizes EGLN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

EGLN1 siRNA

20-abx915075
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EGLN1 siRNA

20-abx915076
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EGLN1 Antibody

ABD6285 100 ug
EUR 438

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Human EGLN1 shRNA Plasmid

20-abx960144
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

EGLN1 Recombinant Protein (Human)

RP010303 100 ug Ask for price

EGLN1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0662402 1.0 ug DNA
EUR 154

EGLN1 Blocking Peptide

DF6285-BP 1mg
EUR 195

EGLN1 Polyclonal Antibody

A-2702 100 µl
EUR 483.55
Description: fast delivery possible

EGLN1 / EGLN2 Antibody

20-abx125802
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

EGLN1 Conjugated Antibody

C32185 100ul
EUR 397

Polyclonal EGLN1 Antibody

APR07662G 0.1mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EGLN1 . This antibody is tested and proven to work in the following applications:

EGLN1 cloning plasmid

CSB-CL863932HU-10ug 10ug
EUR 217
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 387
  • Sequence: atggttgcttgttatccgggcaatggaacgggttatgtacgtcatgttgataatccaaatggagatggaagatgtgtgacatgtatatattatcttaataaagactgggatgccaaggtaagtggaggtatacttcgaatttttccagaaggcaaagcccagtttgctgacattga
  • Show more
Description: A cloning plasmid for the EGLN1 gene.

EGLN1 Rabbit pAb

A2314-100ul 100 ul
EUR 308

EGLN1 Rabbit pAb

A2314-200ul 200 ul
EUR 459

EGLN1 Rabbit pAb

A2314-20ul 20 ul
EUR 183

EGLN1 Rabbit pAb

A2314-50ul 50 ul
EUR 223

anti- EGLN1 antibody

FNab10184 100µg
EUR 505.25
  • Recommended dilution: IHC: 1:50-1:500
  • Immunogen: Egl nine homolog 1
  • Uniprot ID: Q9GZT9
  • Gene ID: 54583
Description: Antibody raised against EGLN1

Anti-EGLN1 antibody

STJ116175 100 µl
EUR 277
Description: The protein encoded by this gene catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular oxygen sensor, and under normal oxygen concentration, modification by prolyl hydroxylation is a key regulatory event that targets HIF subunits for proteasomal destruction via the von Hippel-Lindau ubiquitylation complex. Mutations in this gene are associated with erythrocytosis familial type 3 (ECYT3).

Anti-EGLN1 antibody

STJ116768 100 µl
EUR 413
Description: The protein encoded by this gene catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular oxygen sensor, and under normal oxygen concentration, modification by prolyl hydroxylation is a key regulatory event that targets HIF subunits for proteasomal destruction via the von Hippel-Lindau ubiquitylation complex. Mutations in this gene are associated with erythrocytosis familial type 3 (ECYT3).

Anti-EGLN1 antibody

STJ23492 100 µl
EUR 277
Description: The protein encoded by this gene catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular oxygen sensor, and under normal oxygen concentration, modification by prolyl hydroxylation is a key regulatory event that targets HIF subunits for proteasomal destruction via the von Hippel-Lindau ubiquitylation complex. Mutations in this gene are associated with erythrocytosis familial type 3 (ECYT3).

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Human Notch Homolog 1 ELISA kit

E01N0594-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Notch Homolog 1 ELISA kit

E01N0594-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Notch Homolog 1 ELISA kit

E01N0594-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Anti-CELSR3/Flamingo Homolog 1 Antibody

A07204-1 100ul
EUR 397
Description: Rabbit Polyclonal CELSR3/Flamingo Homolog 1 Antibody. Validated in IF and tested in Human, Mouse, Rat.

Human EGLN1(Egl 9 Homolog 1) ELISA Package