Human EGLN1(Egl Nine Homolog 1) ELISA Kit

Human EGLN1(Egl 9 Homolog 1) ELISA Package

Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit

RDR-EGLN1-Mu-48Tests 48 Tests
EUR 603

Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit

RDR-EGLN1-Mu-96Tests 96 Tests
EUR 840

Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit

RD-EGLN1-Mu-48Tests 48 Tests
EUR 577

Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit

RD-EGLN1-Mu-96Tests 96 Tests
EUR 802

Egl Nine Homolog 1 (EGLN1) Antibody

  • EUR 1302.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Egl Nine Homolog 1 (EGLN1) Antibody

  • EUR 1344.00
  • EUR 634.00
  • 1 mg
  • 200 ug
  • Please enquire.

Egl Nine Homolog 1 (EGLN1) Antibody

  • EUR 1344.00
  • EUR 634.00
  • 1 mg
  • 200 ug
  • Please enquire.

Egl Nine Homolog 1 (EGLN1) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Egl Nine Homolog 1 (EGLN1) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Egl Nine Homolog 1 (EGLN1) Antibody

  • EUR 704.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Egl Nine Homolog 1 (EGLN1) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Egl Nine Homolog 1 (EGLN1) Antibody

  • EUR 926.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Egl Nine Homolog 1 (EGLN1) Antibody

abx030444-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Egl Nine Homolog 1 (EGLN1) Antibody

abx030444-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Egl Nine Homolog 1 (EGLN1) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Egl Nine Homolog 1 (EGLN1) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Egl Nine Homolog 1 (EGLN1) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Egl Nine Homolog 1 (EGLN1) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Egl Nine Homolog 1 (EGLN1) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Egl Nine Homolog 1 (EGLN1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human Egl Nine Homolog 1 (EGLN1)ELISA Kit

201-12-2501 96 tests
EUR 440
  • This Egl Nine Homolog 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Egl nine homolog 1, EGLN1 ELISA KIT

ELI-32637h 96 Tests
EUR 824

Human Egl Nine Homolog 1(EGLN1)ELISA Kit

QY-E04950 96T
EUR 361

Human Egl Nine Homolog 1 (EGLN1) ELISA Kit

SEL644Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Egl Nine Homolog 1 (EGLN1) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Egl Nine Homolog 1 (EGLN1) ELISA Kit

SEL644Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Egl Nine Homolog 1 (EGLN1) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Egl Nine Homolog 1 (EGLN1) ELISA Kit

SEL644Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Egl Nine Homolog 1 (EGLN1) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Egl Nine Homolog 1 (EGLN1) ELISA Kit

SEL644Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Egl Nine Homolog 1 (EGLN1) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Egl Nine Homolog 1 (EGLN1) ELISA Kit

  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Egl Nine Homolog 1 elisa. Alternative names of the recognized antigen: ECYT3
  • HIFPH2
  • PHD2
  • C1orf12
  • SM20
  • ZMYND6
  • HIF Prolyl Hydroxylase 2
  • Prolyl hydroxylase domain-containing protein 2
  • Hypoxia-inducible factor prolyl hydroxylase 2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Egl Nine Homolog 1 (EGLN1) in samples from Serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Egl Nine Homolog 1 (EGLN1) Protein

  • EUR 620.00
  • EUR 272.00
  • EUR 1859.00
  • EUR 732.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Rat Egl Nine Homolog 1(EGLN1)ELISA Kit

GA-E0941RT-48T 48T
EUR 317

Rat Egl Nine Homolog 1(EGLN1)ELISA Kit

GA-E0941RT-96T 96T
EUR 496

Mouse Egl nine homolog 1, Egln1 ELISA KIT

ELI-32638m 96 Tests
EUR 865

Rat Egl Nine Homolog 1(EGLN1)ELISA Kit

QY-E10711 96T
EUR 361

Mouse Egl Nine Homolog 1(EGLN1)ELISA Kit

QY-E20507 96T
EUR 361

Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit

SEL644Mu-10x96wellstestplate 10x96-wells test plate
EUR 5333.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Egl Nine Homolog 1 (EGLN1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit

SEL644Mu-1x48wellstestplate 1x48-wells test plate
EUR 526.89
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Egl Nine Homolog 1 (EGLN1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit

SEL644Mu-1x96wellstestplate 1x96-wells test plate
EUR 709.84
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Egl Nine Homolog 1 (EGLN1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit

SEL644Mu-5x96wellstestplate 5x96-wells test plate
EUR 2894.28
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Egl Nine Homolog 1 (EGLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Egl Nine Homolog 1 (EGLN1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Egl Nine Homolog 1 (EGLN1) ELISA Kit

  • EUR 5384.00
  • EUR 2845.00
  • EUR 710.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Egl Nine Homolog 1 elisa. Alternative names of the recognized antigen: ECYT3
  • HIFPH2
  • PHD2
  • C1orf12
  • SM20
  • ZMYND6
  • HIF Prolyl Hydroxylase 2
  • Prolyl hydroxylase domain-containing protein 2
  • Hypoxia-inducible factor prolyl hydroxylase 2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Egl Nine Homolog 1 (EGLN1) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Egl Nine Homolog 1 (EGLN1) CLIA Kit

  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human EGLN1 (Egl Nine Homolog 1)

ELK7299 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Egl Nine Homolog 1 (EGLN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Egl Nin
  • Show more
Description: A sandwich ELISA kit for detection of Egl Nine Homolog 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Egl nine homolog 1 (EGLN1)

KTE61942-48T 48T
EUR 354
  • EGLN1 catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular ox
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Egl nine homolog 1 (EGLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Egl nine homolog 1 (EGLN1)

KTE61942-5platesof96wells 5 plates of 96 wells
EUR 2252
  • EGLN1 catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular ox
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Egl nine homolog 1 (EGLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Egl nine homolog 1 (EGLN1)

KTE61942-96T 96T
EUR 572
  • EGLN1 catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular ox
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Egl nine homolog 1 (EGLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mouse Egl Nine Homolog 1 (EGLN1) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mouse Egl Nine Homolog 1 (EGLN1) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Egl nine homolog 1 (EGLN1) polyclonal antibody

ABP-PAB-11633 100 ug Ask for price
    • Product line: Miscellaneous
    • Brand:

Mouse Egl Nine Homolog 1 (EGLN1) CLIA Kit

  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Mouse EGLN1 (Egl Nine Homolog 1)

ELK7994 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Egl Nine Homolog 1 (EGLN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Egl Nin
  • Show more
Description: A sandwich ELISA kit for detection of Egl Nine Homolog 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse Egl nine homolog 1 (EGLN1)

KTE71217-48T 48T
EUR 332
  • EGLN1 catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular ox
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Egl nine homolog 1 (EGLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Egl nine homolog 1 (EGLN1)

KTE71217-5platesof96wells 5 plates of 96 wells
EUR 2115
  • EGLN1 catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular ox
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Egl nine homolog 1 (EGLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Egl nine homolog 1 (EGLN1)

KTE71217-96T 96T
EUR 539
  • EGLN1 catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular ox
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Egl nine homolog 1 (EGLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Egl Nine-Like Protein 1 (EGLN1) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Egl Nine-Like Protein 1 (EGLN1) ELISA Kit

  • EUR 7504.00
  • EUR 3996.00
  • EUR 926.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Egl nine homolog 2 Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Egl nine homolog 3 Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Egl Nine Homolog 3 Protein

  • EUR 1609.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 10 ug
  • 2 µg
  • Shipped within 5-10 working days.

Human Egl nine homolog 2 (EGLN2)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 18.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Egl nine homolog 2(EGLN2),partial expressed in E.coli

Human Egl Nine Homolog 2 (EGLN2) ELISA Kit

abx259775-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Egl nine homolog 2, EGLN2 ELISA KIT

ELI-26924h 96 Tests
EUR 824

Human Egl nine homolog 3, EGLN3 ELISA KIT

ELI-47060h 96 Tests
EUR 824

Mouse Egl nine homolog 2, Egln2 ELISA KIT

ELI-09617m 96 Tests
EUR 865

Mouse Egl nine homolog 3, Egln3 ELISA KIT

ELI-08646m 96 Tests
EUR 865

Egl nine homolog 2 Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Egl nine homolog 3 Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Egl nine homolog 2 Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Egl nine homolog 3 Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Egl nine homolog 2 Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Egl nine homolog 3 Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mouse Egl nine homolog 3 protein (Egln3)

  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 31.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Egl nine homolog 3 protein(Egln3) expressed in E.coli

Egl Nine Homolog 2 (C. Elegans) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Egl Nine Homolog 3 (C. Elegans) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Egl nine homolog 2 (EGLN2) polyclonal antibody

ABP-PAB-11634 100 ug Ask for price
    • Product line: Miscellaneous
    • Brand:

Egl nine homolog 3 (EGLN3) polyclonal antibody

ABP-PAB-11635 100 ug Ask for price
    • Product line: Miscellaneous
    • Brand:

EGLN3 Egl Nine Homolog 3 Human Recombinant Protein

PROTQ9H6Z9 Regular: 10ug
EUR 317
Description: EGLN3 Human Recombinant produced in E. coli is a single polypeptide chain containing 263 amino acids (1-239) and having a molecular mass of 29.8 kDa.;EGLN3 is fused to a 24 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Recombinant Human Egl nine homolog 2 Protein, His, E.coli-100ug

QP5968-ec-100ug 100ug
EUR 408

Recombinant Human Egl nine homolog 2 Protein, His, E.coli-10ug

QP5968-ec-10ug 10ug
EUR 200

Recombinant Human Egl nine homolog 2 Protein, His, E.coli-1mg

QP5968-ec-1mg 1mg
EUR 1632

Recombinant Human Egl nine homolog 2 Protein, His, E.coli-200ug

QP5968-ec-200ug 200ug
EUR 634

Recombinant Human Egl nine homolog 2 Protein, His, E.coli-500ug

QP5968-ec-500ug 500ug
EUR 1060

Recombinant Human Egl nine homolog 2 Protein, His, E.coli-50ug

QP5968-ec-50ug 50ug
EUR 263

Recombinant Mouse Egl nine homolog 3 Protein, His, E.coli-100ug

QP8813-ec-100ug 100ug
EUR 571

Recombinant Mouse Egl nine homolog 3 Protein, His, E.coli-10ug

QP8813-ec-10ug 10ug
EUR 272

Recombinant Mouse Egl nine homolog 3 Protein, His, E.coli-1mg

QP8813-ec-1mg 1mg
EUR 2303

Recombinant Mouse Egl nine homolog 3 Protein, His, E.coli-200ug

QP8813-ec-200ug 200ug
EUR 898

Recombinant Mouse Egl nine homolog 3 Protein, His, E.coli-500ug

QP8813-ec-500ug 500ug
EUR 1514

Recombinant Mouse Egl nine homolog 3 Protein, His, E.coli-50ug

QP8813-ec-50ug 50ug
EUR 362

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Egln1/ Rat Egln1 ELISA Kit

ELI-09616r 96 Tests
EUR 886

EGLN1 ELISA Kit (Human) (OKCD02054)

OKCD02054 96 Wells
EUR 909
Description: Description of target: Cellular oxygen sensor that catalyzes, under normoxic conditions, the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. Hydroxylates a specific proline found in each of the oxygen-dependent degradation (ODD) domains (N-terminal, NODD, and C-terminal, CODD) of HIF1A. Also hydroxylates HIF2A. Has a preference for the CODD site for both HIF1A and HIF1B. Hydroxylated HIFs are then targeted for proteasomal degradation via the von Hippel-Lindau ubiquitination complex. Under hypoxic conditions, the hydroxylation reaction is attenuated allowing HIFs to escape degradation resulting in their translocation to the nucleus, heterodimerization with HIF1B, and increased expression of hypoxy-inducible genes. EGLN1 is the most important isozyme under normoxia and, through regulating the stability of HIF1, involved in various hypoxia-influenced processes such as angiogenesis in retinal and cardiac functionality. Target proteins are preferentially recognized via a LXXLAP motif.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 12.2 pg/mL

EGLN1 ELISA Kit (Human) (OKCA02095)

OKCA02095 96 Wells
EUR 917
Description: Description of target: Cellular oxygen sensor that catalyzes, under normoxic conditions, the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. Hydroxylates a specific proline found in each of the oxygen-dependent degradation (ODD) domains (N-terminal, NODD, and C-terminal, CODD) of HIF1A. Also hydroxylates HIF2A. Has a preference for the CODD site for both HIF1A and HIF1B. Hydroxylated HIFs are then targeted for proteasomal degradation via the von Hippel-Lindau ubiquitination complex. Under hypoxic conditions, the hydroxylation reaction is attenuated allowing HIFs to escape degradation resulting in their translocation to the nucleus, heterodimerization with HIF1B, and increased expression of hypoxy-inducible genes. EGLN1 is the most important isozyme under normoxia and, through regulating the stability of HIF1, involved in various hypoxia-influenced processes such as angiogenesis in retinal and cardiac functionality. Target proteins are preferentially recognized via a LXXLAP motif.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7.8 pg/mL

Egln1 ELISA Kit (Mouse) (OKCD02055)

OKCD02055 96 Wells
EUR 936
Description: Description of target: Cellular oxygen sensor that catalyzes, under normoxic conditions, the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. Hydroxylates a specific proline found in each of the oxygen-dependent degradation (ODD) domains (N-terminal, NODD, and C-terminal, CODD) of HIF1A. Also hydroxylates HIF2A. Has a preference for the CODD site for both HIF1A and HIF1B. Hydroxylated HIFs are then targeted for proteasomal degradation via the von Hippel-Lindau ubiquitination complex. Under hypoxic conditions, the hydroxylation reaction is attenuated allowing HIFs to escape degradation resulting in their translocation to the nucleus, heterodimerization with HIF1B, and increased expression of hypoxy-inducible genes. EGLN1 is the most important isozyme under normoxia and, through regulating the stability of HIF1, involved in various hypoxia-influenced processes such as angiogenesis in retinal and cardiac functionality. Target proteins are preferentially recognized via a LXXLAP motif.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.116 ng/mL

EGLN1 antibody

70R-17019 50 ul
EUR 435
Description: Rabbit polyclonal EGLN1 antibody

EGLN1 Antibody

32185-100ul 100ul
EUR 252

EGLN1 antibody

10R-1165 100 ul
EUR 316
Description: Mouse monoclonal EGLN1 antibody

EGLN1 Antibody

EUR 414

EGLN1 Antibody

42722-100ul 100ul
EUR 252

EGLN1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EGLN1. Recognizes EGLN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:10-1:50

EGLN1 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against EGLN1. Recognizes EGLN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

EGLN1 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against EGLN1. Recognizes EGLN1 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

EGLN1 Antibody

DF6285 200ul
EUR 304
Description: EGLN1 Antibody detects endogenous levels of total EGLN1.

EGLN1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EGLN1. Recognizes EGLN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

EGLN1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against EGLN1. Recognizes EGLN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EGLN1 Antibody

ABD6285 100 ug
EUR 438

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Human EGLN1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

EGLN1 Recombinant Protein (Human)

RP010303 100 ug Ask for price

EGLN1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0662402 1.0 ug DNA
EUR 154

EGLN1 Blocking Peptide

DF6285-BP 1mg
EUR 195

EGLN1 Polyclonal Antibody

A-2702 100 µl
EUR 483.55
Description: fast delivery possible

EGLN1 / EGLN2 Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

EGLN1 Conjugated Antibody

C32185 100ul
EUR 397

Polyclonal EGLN1 Antibody

APR07662G 0.1mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EGLN1 . This antibody is tested and proven to work in the following applications:

EGLN1 cloning plasmid

CSB-CL863932HU-10ug 10ug
EUR 217
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 387
  • Sequence: atggttgcttgttatccgggcaatggaacgggttatgtacgtcatgttgataatccaaatggagatggaagatgtgtgacatgtatatattatcttaataaagactgggatgccaaggtaagtggaggtatacttcgaatttttccagaaggcaaagcccagtttgctgacattga
  • Show more
Description: A cloning plasmid for the EGLN1 gene.

EGLN1 Rabbit pAb

A2314-100ul 100 ul
EUR 308

EGLN1 Rabbit pAb

A2314-200ul 200 ul
EUR 459

EGLN1 Rabbit pAb

A2314-20ul 20 ul
EUR 183

EGLN1 Rabbit pAb

A2314-50ul 50 ul
EUR 223

anti- EGLN1 antibody

FNab10184 100µg
EUR 505.25
  • Recommended dilution: IHC: 1:50-1:500
  • Immunogen: Egl nine homolog 1
  • Uniprot ID: Q9GZT9
  • Gene ID: 54583
Description: Antibody raised against EGLN1

Anti-EGLN1 antibody

STJ116175 100 µl
EUR 277
Description: The protein encoded by this gene catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular oxygen sensor, and under normal oxygen concentration, modification by prolyl hydroxylation is a key regulatory event that targets HIF subunits for proteasomal destruction via the von Hippel-Lindau ubiquitylation complex. Mutations in this gene are associated with erythrocytosis familial type 3 (ECYT3).

Anti-EGLN1 antibody

STJ116768 100 µl
EUR 413
Description: The protein encoded by this gene catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular oxygen sensor, and under normal oxygen concentration, modification by prolyl hydroxylation is a key regulatory event that targets HIF subunits for proteasomal destruction via the von Hippel-Lindau ubiquitylation complex. Mutations in this gene are associated with erythrocytosis familial type 3 (ECYT3).

Anti-EGLN1 antibody

STJ23492 100 µl
EUR 277
Description: The protein encoded by this gene catalyzes the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. HIF is a transcriptional complex that plays a central role in mammalian oxygen homeostasis. This protein functions as a cellular oxygen sensor, and under normal oxygen concentration, modification by prolyl hydroxylation is a key regulatory event that targets HIF subunits for proteasomal destruction via the von Hippel-Lindau ubiquitylation complex. Mutations in this gene are associated with erythrocytosis familial type 3 (ECYT3).

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Anti-CELSR3/Flamingo Homolog 1 Antibody

A07204-1 100ul
EUR 397
Description: Rabbit Polyclonal CELSR3/Flamingo Homolog 1 Antibody. Validated in IF and tested in Human, Mouse, Rat.

Human EGLN1(Egl 9 Homolog 1) ELISA Package