Human DEXI(Dexamethasone Induced Protein) ELISA Kit

Human DEXI(Dexamethasone Precipitated Protein) ELISA Package

Human Dexamethasone Induced Protein (DEXI) ELISA Kit

RDR-DEXI-Hu-96Tests 96 Tests
EUR 820

Human Dexamethasone Induced Protein (DEXI) ELISA Kit

RD-DEXI-Hu-48Tests 48 Tests
EUR 563

Human Dexamethasone Induced Protein (DEXI) ELISA Kit

RD-DEXI-Hu-96Tests 96 Tests
EUR 783

Human DEXI/ Dexamethasone-induced protein ELISA Kit

E0685Hu 1 Kit
EUR 571

Human Dexamethasone Induced Protein (DEXI) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Dexamethasone Induced Protein (DEXI) ELISA Kit

abx251164-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.

Human DEXI(Dexamethasone-induced protein) ELISA Kit

EH1851 96T
EUR 567.6
  • Detection range: 0.78-50 ng/ml
  • Uniprot ID: O95424
  • Alias: DEXI/MYLE(Dexamethasone-induced protein)/Protein MYLE
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.469 ng/ml

Human Dexamethasone- induced protein, DEXI ELISA KIT

ELI-05290h 96 Tests
EUR 824

Human Dexamethasone Induced Protein (DEXI) ELISA Kit

abx571639-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Dexamethasone Induced Protein (DEXI) ELISA Kit

SEQ374Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dexamethasone Induced Protein (DEXI) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dexamethasone Induced Protein (DEXI) in tissue homogenates, cell lysates and other biological fluids.

Human Dexamethasone Induced Protein (DEXI) ELISA Kit

SEQ374Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dexamethasone Induced Protein (DEXI) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dexamethasone Induced Protein (DEXI) in tissue homogenates, cell lysates and other biological fluids.

Human Dexamethasone Induced Protein (DEXI) ELISA Kit

SEQ374Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dexamethasone Induced Protein (DEXI) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dexamethasone Induced Protein (DEXI) in tissue homogenates, cell lysates and other biological fluids.

Human Dexamethasone Induced Protein (DEXI) ELISA Kit

SEQ374Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dexamethasone Induced Protein (DEXI) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dexamethasone Induced Protein (DEXI) in tissue homogenates, cell lysates and other biological fluids.

Human Dexamethasone Induced Protein (DEXI) ELISA Kit

  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Dexamethasone Induced Protein elisa. Alternative names of the recognized antigen: MYLE
  • Dexamethasone Induced Transcript
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Dexamethasone Induced Protein (DEXI) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Dexamethasone Induced Protein (DEXI) Antibody

  • EUR 1316.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Dexamethasone Induced Protein (DEXI) Antibody

  • EUR 926.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Dexamethasone Induced Protein (DEXI) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Dexamethasone Induced Protein (DEXI) Antibody

abx232346-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Human Dexamethasone Induced Protein (DEXI) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mouse Dexamethasone- induced protein, Dexi ELISA KIT

ELI-05291m 96 Tests
EUR 865

Mouse Dexamethasone Induced Protein (DEXI) ELISA Kit

abx517951-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Dexamethasone Induced Protein (DEXI) CLIA Kit

  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human DEXI (Dexamethasone Induced Protein)

ELK6999 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Dexamethasone Induced Protein (DEXI). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific
  • Show more
Description: A sandwich ELISA kit for detection of Dexamethasone Induced Protein from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Dexamethasone Induced Protein (DEXI) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Dexamethasone Induced Protein (DEXI) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Dexamethasone Induced Protein (DEXI) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human RAS, Dexamethasone-Induced 1 (RASD1) ELISA Kit

abx251098-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human RASD1/ Dexamethasone-induced Ras-related protein 1 ELISA Kit

E2129Hu 1 Kit
EUR 571

Human RASD1(Dexamethasone-induced Ras-related protein 1) ELISA Kit

EH1790 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q9Y272
  • Alias: RASD1/Dexamethasone-induced Ras-related protein 1/Activator of G-protein signaling 1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Dexamethasone-Induced Ras-Related Protein 1 (RASD1) ELISA Kit

RDR-RASD1-Hu-48Tests 48 Tests
EUR 544

Human Dexamethasone-Induced Ras-Related Protein 1 (RASD1) ELISA Kit

RDR-RASD1-Hu-96Tests 96 Tests
EUR 756

Human Dexamethasone-Induced Ras-Related Protein 1 (RASD1) ELISA Kit

RD-RASD1-Hu-48Tests 48 Tests
EUR 521

Human Dexamethasone-Induced Ras-Related Protein 1 (RASD1) ELISA Kit

RD-RASD1-Hu-96Tests 96 Tests
EUR 723

Mouse RAS, Dexamethasone-Induced 1 (RASD1) ELISA Kit

abx517697-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat RAS, Dexamethasone-Induced 1 (RASD1) ELISA Kit

abx517698-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

RAS, Dexamethasone-Induced 1 (RASD1) Antibody

abx027211-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

RAS, Dexamethasone-Induced 1 (RASD1) Antibody

abx027211-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.


ELA-E1618h 96 Tests
EUR 824


EF005975 96 Tests
EUR 689

DEXI ELISA Kit (Human) (OKCD09458)

OKCD09458 96 Wells
EUR 909
Description: Description of target: Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab);Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.055ng/mL

DEXI ELISA Kit (Human) (OKEH04268)

OKEH04268 96 Wells
EUR 662
Description: Description of target: ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.34 ng/mL

Dexamethasone (DEX) ELISA Kit

abx364822-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.


EUR 659


EUR 191


AT023 1mg
EUR 1790


abx183974-5g 5 g
EUR 370
  • Shipped within 1-2 weeks.


  • EUR 244.00
  • EUR 509.00
  • 1 g
  • 5 g
  • Shipped within 5-12 working days.


  • EUR 217.00
  • EUR 384.00
  • 100 mg
  • 1 g
  • Shipped within 5-10 working days.


E1KS1322 100mg
EUR 247


CA057-001 1g
EUR 196


AG023 1 mg
EUR 523


HY-14648 10mM/1mL
EUR 113


GP8543-1G 1 g
EUR 90


GP8543-250MG 250 mg
EUR 54


GP8543-5G 5 g
EUR 166

DEXI Recombinant Protein (Human)

RP009178 100 ug Ask for price

PoFAine Dexamethasone,Dex ELISA Kit

CN-01281P1 96T
EUR 439

PoFAine Dexamethasone,Dex ELISA Kit

CN-01281P2 48T
EUR 290

Porcine dexamethasone (Dex) ELISA Kit

QY-E40062 96T
EUR 400

DEXI ELISA Kit (Mouse) (OKEH05391)

OKEH05391 96 Wells
EUR 662
Description: Description of target: ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.316 ng/mL

Dexamethasone acetate

B1926-100 100 mg
EUR 166
Description: Dexamethasone is a potent synthetic member of the glucocorticoid class of steroid drugs that has anti-inflammatory and immunosuppressant properties.

Dexamethasone acetate

B1926-5 5 mg
EUR 108
Description: Dexamethasone is a potent synthetic member of the glucocorticoid class of steroid drugs that has anti-inflammatory and immunosuppressant properties.

Dexamethasone acetate

B1926-5.1 10 mM (in 1mL DMSO)
EUR 142
Description: Dexamethasone is a potent synthetic member of the glucocorticoid class of steroid drugs that has anti-inflammatory and immunosuppressant properties.


80-1142 500 ul
EUR 417
Description: Dexamethasone 21 Conjugate for use in immunoassays

Dexamethasone (DHAP)

A2324-100 100 mg
EUR 166
Description: Glucocorticoid; anti-inflammatory. Reduces levels of activated NF-?B in immature dendritic cells (DCs) and inhibits differentiation into mature DCs. Induces differentiation of human mesenchymal stem cells (MSCs). Also induces autophagy in acute lymphoblas

Dexamethasone (DHAP)

A2324-1000 1 g
EUR 139
Description: Glucocorticoid; anti-inflammatory. Reduces levels of activated NF-?B in immature dendritic cells (DCs) and inhibits differentiation into mature DCs. Induces differentiation of human mesenchymal stem cells (MSCs). Also induces autophagy in acute lymphoblas

Dexamethasone (DHAP)

A2324-5 5 mg
EUR 108
Description: Glucocorticoid; anti-inflammatory. Reduces levels of activated NF-?B in immature dendritic cells (DCs) and inhibits differentiation into mature DCs. Induces differentiation of human mesenchymal stem cells (MSCs). Also induces autophagy in acute lymphoblas

Dexamethasone (DHAP)

A2324-5.1 10 mM (in 1mL DMSO)
EUR 154
Description: Glucocorticoid; anti-inflammatory. Reduces levels of activated NF-?B in immature dendritic cells (DCs) and inhibits differentiation into mature DCs. Induces differentiation of human mesenchymal stem cells (MSCs). Also induces autophagy in acute lymphoblas

Dexamethasone (DHAP)

A2324-5000 5 g
EUR 293
Description: Glucocorticoid; anti-inflammatory. Reduces levels of activated NF-?B in immature dendritic cells (DCs) and inhibits differentiation into mature DCs. Induces differentiation of human mesenchymal stem cells (MSCs). Also induces autophagy in acute lymphoblas

Dexamethasone palmitate

HY-128922 50mg
EUR 245

Dexamethasone (acetate)

HY-14648A 5g
EUR 199

DEXI Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DEXI. Recognizes DEXI from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


PVT18336 2 ug
EUR 231

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

DEXI Recombinant Protein (Rat)

RP197906 100 ug Ask for price

DEXI Recombinant Protein (Mouse)

RP128819 100 ug Ask for price

Human DEXI shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Dexamethasone (10 mM)

EUR 153

Dexamethasone 21 antibody

20-1436 100 ul
EUR 657
Description: Sheep polyclonal Dexamethasone 21 antibody

Dexamethasone Sodium Phosphate

B1588-100 100 mg
EUR 166
Description: Dexamethasone is an interleukin receptor inhibitor and also suppresses COX-2.

Dexamethasone Sodium Phosphate

B1588-5 5 mg
EUR 108
Description: Dexamethasone is an interleukin receptor inhibitor and also suppresses COX-2.

Dexamethasone(21) [HRP]

DAG1086 0.5ml
EUR 714

Dexamethasone phosphate sodium

  • EUR 342.00
  • EUR 648.00
  • 1 g
  • 5 g
  • Shipped within 1-2 weeks.

Dexamethasone Hemisuccinate Antibody

abx411076-1ml 1 ml
EUR 439
  • Shipped within 1 week.

Dexamethasone phosphate disodium

HY-B1829A 10mM/1mL
EUR 113

Dexamethasone 9,11-epoxide

HY-N0348 10mM/1mL
EUR 126

Dexamethasone phosphate disodium

B2744-1G 1 g
EUR 115

Dexamethasone phosphate disodium

B2744-5G 5 g
EUR 277

DEXI Polyclonal Antibody

28740-100ul 100ul
EUR 252

DEXI Polyclonal Antibody

28740-50ul 50ul
EUR 187

DEXI cloning plasmid

CSB-CL529744HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 288
  • Sequence: atgctcggcgcccgggtcgcggcccacctggacgcactgggccccctggtcccctacgtgccgccgccgctgctgccctctatgttctacgtgggcctgttcttcgtcaatgtgctgatcctgtactacgccttcctcatggagtacatcgtcctcaacgtgggcctcgtcttcct
  • Show more
Description: A cloning plasmid for the DEXI gene.

DEXI Polyclonal Antibody

A58766 100 µg
EUR 570.55
Description: Ask the seller for details

DEXI Rabbit pAb

A14879-100ul 100 ul
EUR 308

DEXI Rabbit pAb

A14879-200ul 200 ul
EUR 459

DEXI Rabbit pAb

A14879-20ul 20 ul
EUR 183

DEXI Rabbit pAb

A14879-50ul 50 ul
EUR 223

anti- DEXI antibody

FNab02346 100µg
EUR 548.75
  • Immunogen: dexamethasone-induced transcript
  • Uniprot ID: O95424
  • Gene ID: 28955
  • Research Area: Signal Transduction
Description: Antibody raised against DEXI

Anti-DEXI antibody

PAab02346 100 ug
EUR 386

pSV40- Dexi- m

PVT11649 2 ug
EUR 273

Anti-DEXI antibody

STJ117079 100 µl
EUR 277

Human Estrogen-induced protein pS2 ELISA Kit

201-12-0421 96 tests
EUR 440
  • This Estrogen-induced protein pS2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Prolactin Induced Protein (PIP) ELISA Kit

DLR-PIP-Hu-48T 48T
EUR 554
  • Should the Human Prolactin Induced Protein (PIP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Prolactin Induced Protein (PIP) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Prolactin Induced Protein (PIP) ELISA Kit

DLR-PIP-Hu-96T 96T
EUR 725
  • Should the Human Prolactin Induced Protein (PIP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Prolactin Induced Protein (PIP) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Androgen Induced Protein 1 ELISA kit

E01A0494-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Androgen Induced Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Androgen Induced Protein 1 ELISA kit

E01A0494-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Androgen Induced Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Androgen Induced Protein 1 ELISA kit

E01A0494-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Androgen Induced Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Prolactin Induced Protein (PIP) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Estrogen-induced protein pS2 ELISA Kit

CN-04380H1 96T
EUR 441

Human Estrogen-induced protein pS2 ELISA Kit

CN-04380H2 48T
EUR 291

Human Estrogen-induced protein pS2 ELISA Kit

GA-E0437HM-48T 48T
EUR 289

Human Estrogen-induced protein pS2 ELISA Kit

GA-E0437HM-96T 96T
EUR 466

Human Prolactin Induced Protein(PIP)ELISA Kit

QY-E03948 96T
EUR 361

Human Estrogen-induced protein pS2 ELISA Kit

QY-E03983 96T
EUR 361

Human Prolactin Induced Protein (PIP) ELISA Kit

RDR-PIP-Hu-48Tests 48 Tests
EUR 589

Human Prolactin Induced Protein (PIP) ELISA Kit

RDR-PIP-Hu-96Tests 96 Tests
EUR 820

Human Prolactin Induced Protein (PIP) ELISA Kit

RD-PIP-Hu-48Tests 48 Tests
EUR 563

Human Prolactin Induced Protein (PIP) ELISA Kit

RD-PIP-Hu-96Tests 96 Tests
EUR 783

Human Prolactin Induced Protein (PIP) ELISA Kit

SEM035Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prolactin Induced Protein (PIP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prolactin Induced Protein (PIP) in serum, plasma, tissue homogenates and other biological fluids.

Human Prolactin Induced Protein (PIP) ELISA Kit

SEM035Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prolactin Induced Protein (PIP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prolactin Induced Protein (PIP) in serum, plasma, tissue homogenates and other biological fluids.

Human Prolactin Induced Protein (PIP) ELISA Kit

SEM035Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prolactin Induced Protein (PIP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prolactin Induced Protein (PIP) in serum, plasma, tissue homogenates and other biological fluids.

Human Prolactin Induced Protein (PIP) ELISA Kit

SEM035Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prolactin Induced Protein (PIP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prolactin Induced Protein (PIP) in serum, plasma, tissue homogenates and other biological fluids.

Human Prolactin Induced Protein (PIP) ELISA Kit

  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Prolactin Induced Protein elisa. Alternative names of the recognized antigen: GCDFP15
  • GPIP4
  • BRST2
  • SABP
  • gp17
  • Gross cystic disease fluid protein 15
  • Prolactin-induced protein
  • Secretory actin-binding protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Prolactin Induced Protein (PIP) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

DEXI ORF Vector (Human) (pORF)

ORF003060 1.0 ug DNA
EUR 95

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

DEXI Protein Vector (Human) (pPB-C-His)

PV012237 500 ng
EUR 329

DEXI Protein Vector (Human) (pPB-N-His)

PV012238 500 ng
EUR 329

DEXI Protein Vector (Human) (pPM-C-HA)

PV012239 500 ng
EUR 329

DEXI Protein Vector (Human) (pPM-C-His)

PV012240 500 ng
EUR 329

Dexamethasone (Glucocorticoid receptor ligand)

SIH-259-1G 1 g
EUR 121
  • Dexamethasone is a potent synthetic member of the glucocorticoid class of steroid drugs. It is an anti-inflammatory and immunosuppressant. In cancer patients, it can be give to augment the antiemetic effect of 5-HT3 receptor antagonists, and is also
  • Show more
Description: The substance Dexamethasone is a glucocorticoid receptor ligand. It is synthetically produced and has a purity of >98%. The pure substance is white solid which is soluble to 100 mM in DMSO.

Dexamethasone (Glucocorticoid receptor ligand)

SIH-259-5G 5 g
EUR 289
  • Dexamethasone is a potent synthetic member of the glucocorticoid class of steroid drugs. It is an anti-inflammatory and immunosuppressant. In cancer patients, it can be give to augment the antiemetic effect of 5-HT3 receptor antagonists, and is also
  • Show more
Description: The substance Dexamethasone is a glucocorticoid receptor ligand. It is synthetically produced and has a purity of >98%. The pure substance is white solid which is soluble to 100 mM in DMSO.

DEXI Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DEXI. Recognizes DEXI from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

DEXI Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DEXI. Recognizes DEXI from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

DEXI Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DEXI. Recognizes DEXI from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Mouse DEXI shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DEXI Polyclonal Conjugated Antibody

C28740 100ul
EUR 397

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Human Amphoterin induced protein 1(AMIGO1) ELISA kit

E01A1421-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Amphoterin induced protein 1(AMIGO1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Amphoterin induced protein 1(AMIGO1) ELISA kit

E01A1421-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Amphoterin induced protein 1(AMIGO1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Amphoterin induced protein 1(AMIGO1) ELISA kit

E01A1421-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Amphoterin induced protein 1(AMIGO1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Amphoterin induced protein 2(AMIGO2) ELISA kit

E01A1422-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Amphoterin induced protein 2(AMIGO2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Amphoterin induced protein 2(AMIGO2) ELISA kit

E01A1422-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Amphoterin induced protein 2(AMIGO2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Amphoterin induced protein 2(AMIGO2) ELISA kit

E01A1422-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Amphoterin induced protein 2(AMIGO2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Amphoterin induced protein 3(AMIGO3) ELISA kit

E01A1423-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Amphoterin induced protein 3(AMIGO3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Amphoterin induced protein 3(AMIGO3) ELISA kit

E01A1423-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Amphoterin induced protein 3(AMIGO3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Amphoterin induced protein 3(AMIGO3) ELISA kit

E01A1423-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Amphoterin induced protein 3(AMIGO3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Retinoic acid induced protein 3 ELISA kit

E01R0359-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Retinoic acid induced protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Retinoic acid induced protein 3 ELISA kit

E01R0359-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Retinoic acid induced protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Retinoic acid induced protein 3 ELISA kit

E01R0359-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Retinoic acid induced protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Interferon Gamma Induced Protein 10kDa ELISA kit

E01I0085-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Interferon Gamma Induced Protein 10kDa in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Interferon Gamma Induced Protein 10kDa ELISA kit

E01I0085-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Interferon Gamma Induced Protein 10kDa in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Interferon Gamma Induced Protein 10kDa ELISA kit

E01I0085-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Interferon Gamma Induced Protein 10kDa in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Interferon Induced Protein 35 (IFI35) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Interferon Induced Protein 35 (IFI35) ELISA Kit

abx250430-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Interferon Induced Protein 44 (IFI44) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Human IFI44(Interferon-induced protein 44) ELISA Kit

EH2299 96T
EUR 567.6
  • Detection range: 0.78-50 ng/ml
  • Uniprot ID: Q8TCB0
  • Alias: IFI44/Microtubule-associated protein 44/IFI44/MTAP44
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Homo sapiens;Sensitivity: 0.469 ng/ml

ELISA kit for Human Interferon-induced protein 44

EK4645 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Interferon-induced protein 44 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human IFI44/ Interferon-induced protein 44 ELISA Kit

E1213Hu 1 Kit
EUR 605

Human TPA- induced transmembrane protein, TTMP ELISA KIT

ELI-17042h 96 Tests
EUR 824

Human Amphoterin- induced protein 2, AMIGO2 ELISA KIT

ELI-11792h 96 Tests
EUR 824

Human Amphoterin- induced protein 1, AMIGO1 ELISA KIT

ELI-24134h 96 Tests
EUR 824

Human Estrogen-induced protein pS2(PS2)ELISA Kit

CSB-E08991h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativecompetitive ELISA kit for measuring Human Estrogen-induced protein pS2 (PS2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Estrogen-induced protein pS2(PS2)ELISA Kit

  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativecompetitive ELISA kit for measuring Human Estrogen-induced protein pS2(PS2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Estrogen Induced PS2 Protein (EIPS2) ELISA Kit

abx354368-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Submergence Induced Protein 2 (ADI1) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

ELISA kit for Human PIP (Prolactin Induced Protein)

ELK6287 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Prolactin Induced Protein (PIP). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Pr
  • Show more
Description: A sandwich ELISA kit for detection of Prolactin Induced Protein from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Amphoterin- induced protein 3, AMIGO3 ELISA KIT

ELI-49226h 96 Tests
EUR 824

Human Interferon- induced protein 44, IFI44 ELISA KIT

ELI-37607h 96 Tests
EUR 824

Human Androgen Induced Protein 1(AIG1)ELISA Kit

QY-E00752 96T
EUR 361

DEXI sgRNA CRISPR Lentivector set (Human)

K2765001 3 x 1.0 ug
EUR 339

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Dexamethasone 21-phosphate disodium salt

GL6086-1G 1 g
EUR 110

Dexamethasone 21-phosphate disodium salt

GL6086-5G 5 g
EUR 269

Rat Prolactin Induced Protein (PIP) ELISA Kit

DLR-PIP-Ra-48T 48T
EUR 590
  • Should the Rat Prolactin Induced Protein (PIP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Prolactin Induced Protein (PIP) in samples from serum, plasma or other biological fluids.

Rat Prolactin Induced Protein (PIP) ELISA Kit

DLR-PIP-Ra-96T 96T
EUR 774
  • Should the Rat Prolactin Induced Protein (PIP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Prolactin Induced Protein (PIP) in samples from serum, plasma or other biological fluids.

Mouse Androgen Induced Protein 1 ELISA kit

E03A0494-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Androgen Induced Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Androgen Induced Protein 1 ELISA kit

E03A0494-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Androgen Induced Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Androgen Induced Protein 1 ELISA kit

E03A0494-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Androgen Induced Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Androgen Induced Protein 1 ELISA kit

E04A0494-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Androgen Induced Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Androgen Induced Protein 1 ELISA kit

E04A0494-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Androgen Induced Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Androgen Induced Protein 1 ELISA kit

E04A0494-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Androgen Induced Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Androgen Induced Protein 1 ELISA kit

E02A0494-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Androgen Induced Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Androgen Induced Protein 1 ELISA kit

E02A0494-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Androgen Induced Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Androgen Induced Protein 1 ELISA kit

E02A0494-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Androgen Induced Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Androgen Induced Protein 1 ELISA kit

E06A0494-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Androgen Induced Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Androgen Induced Protein 1 ELISA kit

E06A0494-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Androgen Induced Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Androgen Induced Protein 1 ELISA kit

E06A0494-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Androgen Induced Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Prolactin Induced Protein (PIP) ELISA Kit

  • EUR 7911.00
  • EUR 4215.00
  • EUR 973.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Monkey Androgen Induced Protein 1 ELISA kit

E09A0494-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Androgen Induced Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Androgen Induced Protein 1 ELISA kit

E09A0494-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Androgen Induced Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Androgen Induced Protein 1 ELISA kit

E09A0494-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Androgen Induced Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Androgen Induced Protein 1 ELISA kit

E08A0494-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Androgen Induced Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Androgen Induced Protein 1 ELISA kit

E08A0494-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Androgen Induced Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Androgen Induced Protein 1 ELISA kit

E08A0494-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Androgen Induced Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Androgen Induced Protein 1 ELISA kit

E07A0494-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Androgen Induced Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Androgen Induced Protein 1 ELISA kit

E07A0494-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Androgen Induced Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Androgen Induced Protein 1 ELISA kit

E07A0494-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Androgen Induced Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Prolactin Induced Protein(PIP)ELISA Kit

QY-E10184 96T
EUR 361

Mouse Prolactin Induced Protein(PIP)ELISA Kit

QY-E21236 96T
EUR 361

Rat Prolactin Induced Protein (PIP) ELISA Kit

RDR-PIP-Ra-48Tests 48 Tests
EUR 631

Rat Prolactin Induced Protein (PIP) ELISA Kit

RDR-PIP-Ra-96Tests 96 Tests
EUR 880

Rat Prolactin Induced Protein (PIP) ELISA Kit

RD-PIP-Ra-48Tests 48 Tests
EUR 603

Rat Prolactin Induced Protein (PIP) ELISA Kit

RD-PIP-Ra-96Tests 96 Tests
EUR 840

Rat Prolactin Induced Protein (PIP) ELISA Kit

SEM035Ra-10x96wellstestplate 10x96-wells test plate
EUR 5621.62
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Prolactin Induced Protein (PIP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Prolactin Induced Protein (PIP) in serum, plasma and other biological fluids.

Rat Prolactin Induced Protein (PIP) ELISA Kit

SEM035Ra-1x48wellstestplate 1x48-wells test plate
EUR 550.6
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Prolactin Induced Protein (PIP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Prolactin Induced Protein (PIP) in serum, plasma and other biological fluids.

Rat Prolactin Induced Protein (PIP) ELISA Kit

SEM035Ra-1x96wellstestplate 1x96-wells test plate
EUR 743.72
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Prolactin Induced Protein (PIP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Prolactin Induced Protein (PIP) in serum, plasma and other biological fluids.

Rat Prolactin Induced Protein (PIP) ELISA Kit

SEM035Ra-5x96wellstestplate 5x96-wells test plate
EUR 3046.74
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Prolactin Induced Protein (PIP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Prolactin Induced Protein (PIP) in serum, plasma and other biological fluids.

Rat Prolactin Induced Protein (PIP) ELISA Kit

  • EUR 5672.00
  • EUR 2997.00
  • EUR 744.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Prolactin Induced Protein elisa. Alternative names of the recognized antigen: GCDFP15
  • GPIP4
  • BRST2
  • SABP
  • gp17
  • Gross cystic disease fluid protein 15
  • Prolactin-induced protein
  • Secretory actin-binding protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Prolactin Induced Protein (PIP) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Interleukin 4 Induced Protein 1 (IL4I1)ELISA Kit

201-12-2767 96 tests
EUR 440
  • This Interleukin 4 Induced Protein 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

ELISA kit for Human AIG1 (Androgen Induced Protein 1)

E-EL-H0303 1 plate of 96 wells
EUR 534
  • Gentaur's AIG1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human AIG1. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human AIG1 (Androgen Induced Protein 1) in samples from Serum, Plasma, Cell supernatant

Human Interferon Gamma Induced Protein 10kDa (IP10) ELISA Kit

DLR-IP10-Hu-48T 48T
EUR 302
  • Should the Human Interferon Gamma Induced Protein 10kDa (IP10) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Interferon Gamma Induced Protein 10kDa (IP10) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Interferon Gamma Induced Protein 10kDa (IP10) ELISA Kit

DLR-IP10-Hu-96T 96T
EUR 378
  • Should the Human Interferon Gamma Induced Protein 10kDa (IP10) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Interferon Gamma Induced Protein 10kDa (IP10) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Interleukin 4 Induced Protein 1 (IL4I1) ELISA Kit

DLR-IL4I1-Hu-48T 48T
EUR 463
  • Should the Human Interleukin 4 Induced Protein 1 (IL4I1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Interleukin 4 Induced Protein 1 (IL4I1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Interleukin 4 Induced Protein 1 (IL4I1) ELISA Kit

DLR-IL4I1-Hu-96T 96T
EUR 599
  • Should the Human Interleukin 4 Induced Protein 1 (IL4I1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Interleukin 4 Induced Protein 1 (IL4I1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Arginine vasopressin induced protein 1(AVPI1) ELISA kit

E01A1780-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Arginine vasopressin induced protein 1(AVPI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Arginine vasopressin induced protein 1(AVPI1) ELISA kit

E01A1780-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Arginine vasopressin induced protein 1(AVPI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Arginine vasopressin induced protein 1(AVPI1) ELISA kit

E01A1780-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Arginine vasopressin induced protein 1(AVPI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Insulin induced gene 2 protein(INSIG2) ELISA kit

E01I0436-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Insulin induced gene 2 protein(INSIG2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Insulin induced gene 2 protein(INSIG2) ELISA kit

E01I0436-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Insulin induced gene 2 protein(INSIG2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Insulin induced gene 2 protein(INSIG2) ELISA kit

E01I0436-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Insulin induced gene 2 protein(INSIG2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Interleukin 4 Induced Protein 1 (IL4I1) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Interferon Induced Transmembrane Protein 3 (IFITM3) ELISA Kit

abx250358-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Human Interferon Induced Transmembrane Protein 10 (IFITM10) ELISA Kit

abx251762-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human IFITM10(Interferon-induced transmembrane protein 10) ELISA Kit

EH2400 96T
EUR 567.6
  • Detection range: 15.6-1000 pg/ml
  • Uniprot ID: A6NMD0
  • Alias: IFITM10/Dispanin subfamily A member 3
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml

Human GILZ(Glucocorticoid-induced leucine zipper protein) ELISA Kit

EH8776 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
Description: Method of detection: Sandwich ELISA, Double Antigen;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human IFITM2(Interferon-induced transmembrane protein 2)ELISA Kit

EH9300 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

ELISA kit for Human Interferon-induced transmembrane protein 3

EK2513 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Interferon-induced transmembrane protein 3 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Interferon-induced 35 kDa protein

EK2635 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Interferon-induced 35 kDa protein in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Oncoprotein-induced transcript 3 protein

EK3911 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Oncoprotein-induced transcript 3 protein in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Interferon-induced transmembrane protein 10

EK4831 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Interferon-induced transmembrane protein 10 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human IFI35/ Interferon-induced 35 kDa protein ELISA Kit

E1212Hu 1 Kit
EUR 605

Human IFITM10/ Interferon-induced transmembrane protein 10 ELISA Kit

E1217Hu 1 Kit
EUR 605

Human DEXI(Dexamethasone Precipitated Protein) ELISA Package