Human DEXI(Dexamethasone Precipitated Protein) ELISA Package
Human Dexamethasone Induced Protein (DEXI) ELISA Kit |
RDR-DEXI-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 820 |
Human Dexamethasone Induced Protein (DEXI) ELISA Kit |
RD-DEXI-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 563 |
Human Dexamethasone Induced Protein (DEXI) ELISA Kit |
RD-DEXI-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 783 |
Human DEXI/ Dexamethasone-induced protein ELISA Kit |
E0685Hu |
Sunlong |
1 Kit |
EUR 571 |
Human Dexamethasone Induced Protein (DEXI) ELISA Kit |
20-abx151306 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Dexamethasone Induced Protein (DEXI) ELISA Kit |
abx251164-96tests |
Abbexa |
96 tests |
EUR 746 |
- Shipped within 5-12 working days.
|
Human DEXI(Dexamethasone-induced protein) ELISA Kit |
EH1851 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.78-50 ng/ml
- Uniprot ID: O95424
- Alias: DEXI/MYLE(Dexamethasone-induced protein)/Protein MYLE
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.469 ng/ml |
Human Dexamethasone- induced protein, DEXI ELISA KIT |
ELI-05290h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Dexamethasone Induced Protein (DEXI) ELISA Kit |
abx571639-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Dexamethasone Induced Protein (DEXI) ELISA Kit |
SEQ374Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5189.65 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dexamethasone Induced Protein (DEXI) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay:
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dexamethasone Induced Protein (DEXI) in tissue homogenates, cell lysates and other biological fluids. |
Human Dexamethasone Induced Protein (DEXI) ELISA Kit |
SEQ374Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 515.03 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dexamethasone Induced Protein (DEXI) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay:
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dexamethasone Induced Protein (DEXI) in tissue homogenates, cell lysates and other biological fluids. |
Human Dexamethasone Induced Protein (DEXI) ELISA Kit |
SEQ374Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 692.9 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dexamethasone Induced Protein (DEXI) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay:
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dexamethasone Induced Protein (DEXI) in tissue homogenates, cell lysates and other biological fluids. |
Human Dexamethasone Induced Protein (DEXI) ELISA Kit |
SEQ374Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2818.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dexamethasone Induced Protein (DEXI) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay:
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dexamethasone Induced Protein (DEXI) in tissue homogenates, cell lysates and other biological fluids. |
Human Dexamethasone Induced Protein (DEXI) ELISA Kit |
4-SEQ374Hu |
Cloud-Clone |
-
EUR 5240.00
-
EUR 2769.00
-
EUR 693.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Dexamethasone Induced Protein elisa. Alternative names of the recognized antigen: MYLE
- Dexamethasone Induced Transcript
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Dexamethasone Induced Protein (DEXI) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Dexamethasone Induced Protein (DEXI) Antibody |
20-abx176156 |
Abbexa |
|
|
|
Dexamethasone Induced Protein (DEXI) Antibody |
20-abx172104 |
Abbexa |
|
|
|
Dexamethasone Induced Protein (DEXI) Antibody |
20-abx301375 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Dexamethasone Induced Protein (DEXI) Antibody |
abx232346-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Human Dexamethasone Induced Protein (DEXI) Protein |
20-abx653170 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Mouse Dexamethasone- induced protein, Dexi ELISA KIT |
ELI-05291m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Dexamethasone Induced Protein (DEXI) ELISA Kit |
abx517951-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Dexamethasone Induced Protein (DEXI) CLIA Kit |
20-abx496188 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Human DEXI (Dexamethasone Induced Protein) |
ELK6999 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Dexamethasone Induced Protein (DEXI). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific
- Show more
|
Description: A sandwich ELISA kit for detection of Dexamethasone Induced Protein from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Dexamethasone Induced Protein (DEXI) Antibody (HRP) |
20-abx306688 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Dexamethasone Induced Protein (DEXI) Antibody (FITC) |
20-abx306689 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Dexamethasone Induced Protein (DEXI) Antibody (Biotin) |
20-abx306690 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Human RAS, Dexamethasone-Induced 1 (RASD1) ELISA Kit |
abx251098-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human RASD1/ Dexamethasone-induced Ras-related protein 1 ELISA Kit |
E2129Hu |
Sunlong |
1 Kit |
EUR 571 |
Human RASD1(Dexamethasone-induced Ras-related protein 1) ELISA Kit |
EH1790 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: Q9Y272
- Alias: RASD1/Dexamethasone-induced Ras-related protein 1/Activator of G-protein signaling 1
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Human Dexamethasone-Induced Ras-Related Protein 1 (RASD1) ELISA Kit |
RDR-RASD1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Dexamethasone-Induced Ras-Related Protein 1 (RASD1) ELISA Kit |
RDR-RASD1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Dexamethasone-Induced Ras-Related Protein 1 (RASD1) ELISA Kit |
RD-RASD1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Dexamethasone-Induced Ras-Related Protein 1 (RASD1) ELISA Kit |
RD-RASD1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Mouse RAS, Dexamethasone-Induced 1 (RASD1) ELISA Kit |
abx517697-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Rat RAS, Dexamethasone-Induced 1 (RASD1) ELISA Kit |
abx517698-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
RAS, Dexamethasone-Induced 1 (RASD1) Antibody |
abx027211-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
RAS, Dexamethasone-Induced 1 (RASD1) Antibody |
abx027211-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Dexamethasone (DEX) ELISA Kit |
abx364822-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Dexamethasone |
abx183974-5g |
Abbexa |
5 g |
EUR 370 |
- Shipped within 1-2 weeks.
|
Dexamethasone |
20-abx076546 |
Abbexa |
|
|
- Shipped within 5-12 working days.
|
Dexamethasone |
20-abx082283 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Dexamethasone |
E1KS1322 |
EnoGene |
100mg |
EUR 247 |
Dexamethasone |
CA057-001 |
GenDepot |
1g |
EUR 196 |
DEXI Recombinant Protein (Human) |
RP009178 |
ABM |
100 ug |
Ask for price |
PoFAine Dexamethasone,Dex ELISA Kit |
CN-01281P1 |
ChemNorm |
96T |
EUR 439 |
PoFAine Dexamethasone,Dex ELISA Kit |
CN-01281P2 |
ChemNorm |
48T |
EUR 290 |
Dexamethasone acetate |
B1926-100 |
ApexBio |
100 mg |
EUR 166 |
Description: Dexamethasone is a potent synthetic member of the glucocorticoid class of steroid drugs that has anti-inflammatory and immunosuppressant properties. |
Dexamethasone acetate |
B1926-5 |
ApexBio |
5 mg |
EUR 108 |
Description: Dexamethasone is a potent synthetic member of the glucocorticoid class of steroid drugs that has anti-inflammatory and immunosuppressant properties. |
Dexamethasone acetate |
B1926-5.1 |
ApexBio |
10 mM (in 1mL DMSO) |
EUR 142 |
Description: Dexamethasone is a potent synthetic member of the glucocorticoid class of steroid drugs that has anti-inflammatory and immunosuppressant properties. |
Dexamethasone-HRP |
80-1142 |
Fitzgerald |
500 ul |
EUR 417 |
Description: Dexamethasone 21 Conjugate for use in immunoassays |
Dexamethasone (DHAP) |
A2324-100 |
ApexBio |
100 mg |
EUR 166 |
Description: Glucocorticoid; anti-inflammatory. Reduces levels of activated NF-?B in immature dendritic cells (DCs) and inhibits differentiation into mature DCs. Induces differentiation of human mesenchymal stem cells (MSCs). Also induces autophagy in acute lymphoblas |
Dexamethasone (DHAP) |
A2324-1000 |
ApexBio |
1 g |
EUR 139 |
Description: Glucocorticoid; anti-inflammatory. Reduces levels of activated NF-?B in immature dendritic cells (DCs) and inhibits differentiation into mature DCs. Induces differentiation of human mesenchymal stem cells (MSCs). Also induces autophagy in acute lymphoblas |
Dexamethasone (DHAP) |
A2324-5 |
ApexBio |
5 mg |
EUR 108 |
Description: Glucocorticoid; anti-inflammatory. Reduces levels of activated NF-?B in immature dendritic cells (DCs) and inhibits differentiation into mature DCs. Induces differentiation of human mesenchymal stem cells (MSCs). Also induces autophagy in acute lymphoblas |
Dexamethasone (DHAP) |
A2324-5.1 |
ApexBio |
10 mM (in 1mL DMSO) |
EUR 154 |
Description: Glucocorticoid; anti-inflammatory. Reduces levels of activated NF-?B in immature dendritic cells (DCs) and inhibits differentiation into mature DCs. Induces differentiation of human mesenchymal stem cells (MSCs). Also induces autophagy in acute lymphoblas |
Dexamethasone (DHAP) |
A2324-5000 |
ApexBio |
5 g |
EUR 293 |
Description: Glucocorticoid; anti-inflammatory. Reduces levels of activated NF-?B in immature dendritic cells (DCs) and inhibits differentiation into mature DCs. Induces differentiation of human mesenchymal stem cells (MSCs). Also induces autophagy in acute lymphoblas |
DEXI Antibody |
1-CSB-PA529744LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against DEXI. Recognizes DEXI from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
DEXI siRNA |
20-abx914034 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DEXI siRNA |
20-abx914035 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
DEXI Recombinant Protein (Rat) |
RP197906 |
ABM |
100 ug |
Ask for price |
DEXI Recombinant Protein (Mouse) |
RP128819 |
ABM |
100 ug |
Ask for price |
Human DEXI shRNA Plasmid |
20-abx959124 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Dexamethasone (10 mM) |
1042-1 |
Biovision |
|
EUR 153 |
Dexamethasone 21 antibody |
20-1436 |
Fitzgerald |
100 ul |
EUR 657 |
Description: Sheep polyclonal Dexamethasone 21 antibody |
Dexamethasone Sodium Phosphate |
B1588-100 |
ApexBio |
100 mg |
EUR 166 |
Description: Dexamethasone is an interleukin receptor inhibitor and also suppresses COX-2. |
Dexamethasone Sodium Phosphate |
B1588-5 |
ApexBio |
5 mg |
EUR 108 |
Description: Dexamethasone is an interleukin receptor inhibitor and also suppresses COX-2. |
Dexamethasone phosphate sodium |
20-abx183975 |
Abbexa |
|
|
- Shipped within 1-2 weeks.
|
Dexamethasone Hemisuccinate Antibody |
abx411076-1ml |
Abbexa |
1 ml |
EUR 439 |
|
Dexamethasone phosphate disodium |
HY-B1829A |
MedChemExpress |
10mM/1mL |
EUR 113 |
Dexamethasone phosphate disodium |
B2744-1G |
Biovision |
1 g |
EUR 115 |
Dexamethasone phosphate disodium |
B2744-5G |
Biovision |
5 g |
EUR 277 |
DEXI Polyclonal Antibody |
28740-100ul |
SAB |
100ul |
EUR 252 |
DEXI Polyclonal Antibody |
28740-50ul |
SAB |
50ul |
EUR 187 |
DEXI cloning plasmid |
CSB-CL529744HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 288
- Sequence: atgctcggcgcccgggtcgcggcccacctggacgcactgggccccctggtcccctacgtgccgccgccgctgctgccctctatgttctacgtgggcctgttcttcgtcaatgtgctgatcctgtactacgccttcctcatggagtacatcgtcctcaacgtgggcctcgtcttcct
- Show more
|
Description: A cloning plasmid for the DEXI gene. |
DEXI Polyclonal Antibody |
A58766 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
DEXI Rabbit pAb |
A14879-100ul |
Abclonal |
100 ul |
EUR 308 |
DEXI Rabbit pAb |
A14879-200ul |
Abclonal |
200 ul |
EUR 459 |
DEXI Rabbit pAb |
A14879-20ul |
Abclonal |
20 ul |
EUR 183 |
DEXI Rabbit pAb |
A14879-50ul |
Abclonal |
50 ul |
EUR 223 |
anti- DEXI antibody |
FNab02346 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: dexamethasone-induced transcript
- Uniprot ID: O95424
- Gene ID: 28955
- Research Area: Signal Transduction
|
Description: Antibody raised against DEXI |
Human Estrogen-induced protein pS2 ELISA Kit |
201-12-0421 |
SunredBio |
96 tests |
EUR 440 |
- This Estrogen-induced protein pS2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Prolactin Induced Protein (PIP) ELISA Kit |
DLR-PIP-Hu-48T |
DL Develop |
48T |
EUR 554 |
- Should the Human Prolactin Induced Protein (PIP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Prolactin Induced Protein (PIP) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Prolactin Induced Protein (PIP) ELISA Kit |
DLR-PIP-Hu-96T |
DL Develop |
96T |
EUR 725 |
- Should the Human Prolactin Induced Protein (PIP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Prolactin Induced Protein (PIP) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Androgen Induced Protein 1 ELISA kit |
E01A0494-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Androgen Induced Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Androgen Induced Protein 1 ELISA kit |
E01A0494-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Androgen Induced Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Androgen Induced Protein 1 ELISA kit |
E01A0494-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Androgen Induced Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Prolactin Induced Protein (PIP) ELISA Kit |
20-abx152748 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Estrogen-induced protein pS2 ELISA Kit |
CN-04380H1 |
ChemNorm |
96T |
EUR 441 |
Human Estrogen-induced protein pS2 ELISA Kit |
CN-04380H2 |
ChemNorm |
48T |
EUR 291 |
Human Estrogen-induced protein pS2 ELISA Kit |
GA-E0437HM-48T |
GenAsia Biotech |
48T |
EUR 289 |
Human Estrogen-induced protein pS2 ELISA Kit |
GA-E0437HM-96T |
GenAsia Biotech |
96T |
EUR 466 |
Human Prolactin Induced Protein (PIP) ELISA Kit |
RDR-PIP-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 589 |
Human Prolactin Induced Protein (PIP) ELISA Kit |
RDR-PIP-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 820 |
Human Prolactin Induced Protein (PIP) ELISA Kit |
RD-PIP-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 563 |
Human Prolactin Induced Protein (PIP) ELISA Kit |
RD-PIP-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 783 |
Human Prolactin Induced Protein (PIP) ELISA Kit |
SEM035Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5189.65 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prolactin Induced Protein (PIP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<1
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prolactin Induced Protein (PIP) in serum, plasma, tissue homogenates and other biological fluids. |
Human Prolactin Induced Protein (PIP) ELISA Kit |
SEM035Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 515.03 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prolactin Induced Protein (PIP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<1
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prolactin Induced Protein (PIP) in serum, plasma, tissue homogenates and other biological fluids. |
Human Prolactin Induced Protein (PIP) ELISA Kit |
SEM035Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 692.9 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prolactin Induced Protein (PIP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<1
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prolactin Induced Protein (PIP) in serum, plasma, tissue homogenates and other biological fluids. |
Human Prolactin Induced Protein (PIP) ELISA Kit |
SEM035Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2818.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prolactin Induced Protein (PIP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<1
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prolactin Induced Protein (PIP) in serum, plasma, tissue homogenates and other biological fluids. |
Human Prolactin Induced Protein (PIP) ELISA Kit |
4-SEM035Hu |
Cloud-Clone |
-
EUR 5240.00
-
EUR 2769.00
-
EUR 693.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Prolactin Induced Protein elisa. Alternative names of the recognized antigen: GCDFP15
- GPIP4
- BRST2
- SABP
- gp17
- Gross cystic disease fluid protein 15
- Prolactin-induced protein
- Secretory actin-binding protein
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Prolactin Induced Protein (PIP) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
DEXI ORF Vector (Human) (pORF) |
ORF003060 |
ABM |
1.0 ug DNA |
EUR 95 |
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
DEXI Protein Vector (Human) (pPB-C-His) |
PV012237 |
ABM |
500 ng |
EUR 329 |
DEXI Protein Vector (Human) (pPB-N-His) |
PV012238 |
ABM |
500 ng |
EUR 329 |
DEXI Protein Vector (Human) (pPM-C-HA) |
PV012239 |
ABM |
500 ng |
EUR 329 |
DEXI Protein Vector (Human) (pPM-C-His) |
PV012240 |
ABM |
500 ng |
EUR 329 |
Dexamethasone (Glucocorticoid receptor ligand) |
SIH-259-1G |
Stressmarq |
1 g |
EUR 121 |
- Dexamethasone is a potent synthetic member of the glucocorticoid class of steroid drugs. It is an anti-inflammatory and immunosuppressant. In cancer patients, it can be give to augment the antiemetic effect of 5-HT3 receptor antagonists, and is also
- Show more
|
Description: The substance Dexamethasone is a glucocorticoid receptor ligand. It is synthetically produced and has a purity of >98%. The pure substance is white solid which is soluble to 100 mM in DMSO. |
Dexamethasone (Glucocorticoid receptor ligand) |
SIH-259-5G |
Stressmarq |
5 g |
EUR 289 |
- Dexamethasone is a potent synthetic member of the glucocorticoid class of steroid drugs. It is an anti-inflammatory and immunosuppressant. In cancer patients, it can be give to augment the antiemetic effect of 5-HT3 receptor antagonists, and is also
- Show more
|
Description: The substance Dexamethasone is a glucocorticoid receptor ligand. It is synthetically produced and has a purity of >98%. The pure substance is white solid which is soluble to 100 mM in DMSO. |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
Human Amphoterin induced protein 1(AMIGO1) ELISA kit |
E01A1421-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Amphoterin induced protein 1(AMIGO1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Amphoterin induced protein 1(AMIGO1) ELISA kit |
E01A1421-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Amphoterin induced protein 1(AMIGO1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Amphoterin induced protein 1(AMIGO1) ELISA kit |
E01A1421-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Amphoterin induced protein 1(AMIGO1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Amphoterin induced protein 2(AMIGO2) ELISA kit |
E01A1422-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Amphoterin induced protein 2(AMIGO2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Amphoterin induced protein 2(AMIGO2) ELISA kit |
E01A1422-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Amphoterin induced protein 2(AMIGO2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Amphoterin induced protein 2(AMIGO2) ELISA kit |
E01A1422-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Amphoterin induced protein 2(AMIGO2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Amphoterin induced protein 3(AMIGO3) ELISA kit |
E01A1423-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Amphoterin induced protein 3(AMIGO3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Amphoterin induced protein 3(AMIGO3) ELISA kit |
E01A1423-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Amphoterin induced protein 3(AMIGO3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Amphoterin induced protein 3(AMIGO3) ELISA kit |
E01A1423-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Amphoterin induced protein 3(AMIGO3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Retinoic acid induced protein 3 ELISA kit |
E01R0359-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Retinoic acid induced protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Retinoic acid induced protein 3 ELISA kit |
E01R0359-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Retinoic acid induced protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Retinoic acid induced protein 3 ELISA kit |
E01R0359-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Retinoic acid induced protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Interferon Gamma Induced Protein 10kDa ELISA kit |
E01I0085-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Interferon Gamma Induced Protein 10kDa in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Interferon Gamma Induced Protein 10kDa ELISA kit |
E01I0085-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Interferon Gamma Induced Protein 10kDa in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Interferon Gamma Induced Protein 10kDa ELISA kit |
E01I0085-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Interferon Gamma Induced Protein 10kDa in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Interferon Induced Protein 35 (IFI35) ELISA Kit |
20-abx258137 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Interferon Induced Protein 35 (IFI35) ELISA Kit |
abx250430-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Interferon Induced Protein 44 (IFI44) ELISA Kit |
20-abx251650 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-12 working days.
|
Human IFI44(Interferon-induced protein 44) ELISA Kit |
EH2299 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.78-50 ng/ml
- Uniprot ID: Q8TCB0
- Alias: IFI44/Microtubule-associated protein 44/IFI44/MTAP44
|
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Homo sapiens;Sensitivity: 0.469 ng/ml |
ELISA kit for Human Interferon-induced protein 44 |
EK4645 |
SAB |
96 tests |
EUR 603 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Interferon-induced protein 44 in samples from serum, plasma, tissue homogenates and other biological fluids. |
Human IFI44/ Interferon-induced protein 44 ELISA Kit |
E1213Hu |
Sunlong |
1 Kit |
EUR 605 |
Human TPA- induced transmembrane protein, TTMP ELISA KIT |
ELI-17042h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Amphoterin- induced protein 2, AMIGO2 ELISA KIT |
ELI-11792h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Amphoterin- induced protein 1, AMIGO1 ELISA KIT |
ELI-24134h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Estrogen-induced protein pS2(PS2)ELISA Kit |
CSB-E08991h-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativecompetitive ELISA kit for measuring Human Estrogen-induced protein pS2 (PS2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Estrogen-induced protein pS2(PS2)ELISA Kit |
1-CSB-E08991h |
Cusabio |
-
EUR 703.00
-
EUR 4843.00
-
EUR 2570.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativecompetitive ELISA kit for measuring Human Estrogen-induced protein pS2(PS2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Estrogen Induced PS2 Protein (EIPS2) ELISA Kit |
abx354368-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human Submergence Induced Protein 2 (ADI1) ELISA Kit |
20-abx385636 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-12 working days.
|
ELISA kit for Human PIP (Prolactin Induced Protein) |
ELK6287 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Prolactin Induced Protein (PIP). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Pr
- Show more
|
Description: A sandwich ELISA kit for detection of Prolactin Induced Protein from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Human Amphoterin- induced protein 3, AMIGO3 ELISA KIT |
ELI-49226h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Interferon- induced protein 44, IFI44 ELISA KIT |
ELI-37607h |
Lifescience Market |
96 Tests |
EUR 824 |
DEXI Antibody, HRP conjugated |
1-CSB-PA529744LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against DEXI. Recognizes DEXI from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
DEXI Antibody, FITC conjugated |
1-CSB-PA529744LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against DEXI. Recognizes DEXI from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
DEXI Antibody, Biotin conjugated |
1-CSB-PA529744LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against DEXI. Recognizes DEXI from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Mouse DEXI shRNA Plasmid |
20-abx975090 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
DEXI Polyclonal Conjugated Antibody |
C28740 |
SAB |
100ul |
EUR 397 |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
DEXI sgRNA CRISPR Lentivector set (Human) |
K2765001 |
ABM |
3 x 1.0 ug |
EUR 339 |
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
Rat Prolactin Induced Protein (PIP) ELISA Kit |
DLR-PIP-Ra-48T |
DL Develop |
48T |
EUR 590 |
- Should the Rat Prolactin Induced Protein (PIP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Prolactin Induced Protein (PIP) in samples from serum, plasma or other biological fluids. |
Rat Prolactin Induced Protein (PIP) ELISA Kit |
DLR-PIP-Ra-96T |
DL Develop |
96T |
EUR 774 |
- Should the Rat Prolactin Induced Protein (PIP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Prolactin Induced Protein (PIP) in samples from serum, plasma or other biological fluids. |
Mouse Androgen Induced Protein 1 ELISA kit |
E03A0494-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Androgen Induced Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Androgen Induced Protein 1 ELISA kit |
E03A0494-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Androgen Induced Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Androgen Induced Protein 1 ELISA kit |
E03A0494-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Androgen Induced Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Androgen Induced Protein 1 ELISA kit |
E04A0494-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Androgen Induced Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Androgen Induced Protein 1 ELISA kit |
E04A0494-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Androgen Induced Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Androgen Induced Protein 1 ELISA kit |
E04A0494-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Androgen Induced Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Androgen Induced Protein 1 ELISA kit |
E02A0494-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Androgen Induced Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Androgen Induced Protein 1 ELISA kit |
E02A0494-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Androgen Induced Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Androgen Induced Protein 1 ELISA kit |
E02A0494-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Androgen Induced Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Androgen Induced Protein 1 ELISA kit |
E06A0494-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Androgen Induced Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Androgen Induced Protein 1 ELISA kit |
E06A0494-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Androgen Induced Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Androgen Induced Protein 1 ELISA kit |
E06A0494-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Androgen Induced Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Prolactin Induced Protein (PIP) ELISA Kit |
20-abx155975 |
Abbexa |
-
EUR 7911.00
-
EUR 4215.00
-
EUR 973.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Monkey Androgen Induced Protein 1 ELISA kit |
E09A0494-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Androgen Induced Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Androgen Induced Protein 1 ELISA kit |
E09A0494-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Androgen Induced Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Androgen Induced Protein 1 ELISA kit |
E09A0494-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Androgen Induced Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Androgen Induced Protein 1 ELISA kit |
E08A0494-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Androgen Induced Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Androgen Induced Protein 1 ELISA kit |
E08A0494-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Androgen Induced Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Androgen Induced Protein 1 ELISA kit |
E08A0494-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Androgen Induced Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Androgen Induced Protein 1 ELISA kit |
E07A0494-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Androgen Induced Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Androgen Induced Protein 1 ELISA kit |
E07A0494-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Androgen Induced Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Androgen Induced Protein 1 ELISA kit |
E07A0494-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Androgen Induced Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Prolactin Induced Protein (PIP) ELISA Kit |
RDR-PIP-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 631 |
Rat Prolactin Induced Protein (PIP) ELISA Kit |
RDR-PIP-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 880 |
Rat Prolactin Induced Protein (PIP) ELISA Kit |
RD-PIP-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 603 |
Rat Prolactin Induced Protein (PIP) ELISA Kit |
RD-PIP-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 840 |
Rat Prolactin Induced Protein (PIP) ELISA Kit |
SEM035Ra-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5621.62 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Prolactin Induced Protein (PIP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Prolactin Induced Protein (PIP) in serum, plasma and other biological fluids. |
Rat Prolactin Induced Protein (PIP) ELISA Kit |
SEM035Ra-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 550.6 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Prolactin Induced Protein (PIP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Prolactin Induced Protein (PIP) in serum, plasma and other biological fluids. |
Rat Prolactin Induced Protein (PIP) ELISA Kit |
SEM035Ra-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 743.72 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Prolactin Induced Protein (PIP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Prolactin Induced Protein (PIP) in serum, plasma and other biological fluids. |
Rat Prolactin Induced Protein (PIP) ELISA Kit |
SEM035Ra-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 3046.74 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Prolactin Induced Protein (PIP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Prolactin Induced Protein (PIP) in serum, plasma and other biological fluids. |
Rat Prolactin Induced Protein (PIP) ELISA Kit |
4-SEM035Ra |
Cloud-Clone |
-
EUR 5672.00
-
EUR 2997.00
-
EUR 744.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Prolactin Induced Protein elisa. Alternative names of the recognized antigen: GCDFP15
- GPIP4
- BRST2
- SABP
- gp17
- Gross cystic disease fluid protein 15
- Prolactin-induced protein
- Secretory actin-binding protein
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Prolactin Induced Protein (PIP) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Human Interleukin 4 Induced Protein 1 (IL4I1)ELISA Kit |
201-12-2767 |
SunredBio |
96 tests |
EUR 440 |
- This Interleukin 4 Induced Protein 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
ELISA kit for Human AIG1 (Androgen Induced Protein 1) |
E-EL-H0303 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's AIG1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human AIG1. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human AIG1 (Androgen Induced Protein 1) in samples from Serum, Plasma, Cell supernatant |
Human Interferon Gamma Induced Protein 10kDa (IP10) ELISA Kit |
DLR-IP10-Hu-48T |
DL Develop |
48T |
EUR 302 |
- Should the Human Interferon Gamma Induced Protein 10kDa (IP10) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Interferon Gamma Induced Protein 10kDa (IP10) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Interferon Gamma Induced Protein 10kDa (IP10) ELISA Kit |
DLR-IP10-Hu-96T |
DL Develop |
96T |
EUR 378 |
- Should the Human Interferon Gamma Induced Protein 10kDa (IP10) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Interferon Gamma Induced Protein 10kDa (IP10) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Interleukin 4 Induced Protein 1 (IL4I1) ELISA Kit |
DLR-IL4I1-Hu-48T |
DL Develop |
48T |
EUR 463 |
- Should the Human Interleukin 4 Induced Protein 1 (IL4I1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Interleukin 4 Induced Protein 1 (IL4I1) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Interleukin 4 Induced Protein 1 (IL4I1) ELISA Kit |
DLR-IL4I1-Hu-96T |
DL Develop |
96T |
EUR 599 |
- Should the Human Interleukin 4 Induced Protein 1 (IL4I1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Interleukin 4 Induced Protein 1 (IL4I1) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Arginine vasopressin induced protein 1(AVPI1) ELISA kit |
E01A1780-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Arginine vasopressin induced protein 1(AVPI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Arginine vasopressin induced protein 1(AVPI1) ELISA kit |
E01A1780-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Arginine vasopressin induced protein 1(AVPI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Arginine vasopressin induced protein 1(AVPI1) ELISA kit |
E01A1780-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Arginine vasopressin induced protein 1(AVPI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Insulin induced gene 2 protein(INSIG2) ELISA kit |
E01I0436-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Insulin induced gene 2 protein(INSIG2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Insulin induced gene 2 protein(INSIG2) ELISA kit |
E01I0436-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Insulin induced gene 2 protein(INSIG2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Insulin induced gene 2 protein(INSIG2) ELISA kit |
E01I0436-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Insulin induced gene 2 protein(INSIG2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Interleukin 4 Induced Protein 1 (IL4I1) ELISA Kit |
20-abx151946 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Interferon Induced Transmembrane Protein 3 (IFITM3) ELISA Kit |
abx250358-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Human Interferon Induced Transmembrane Protein 10 (IFITM10) ELISA Kit |
abx251762-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human IFITM10(Interferon-induced transmembrane protein 10) ELISA Kit |
EH2400 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 15.6-1000 pg/ml
- Uniprot ID: A6NMD0
- Alias: IFITM10/Dispanin subfamily A member 3
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml |
Human GILZ(Glucocorticoid-induced leucine zipper protein) ELISA Kit |
EH8776 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.156-10 ng/ml
|
Description: Method of detection: Sandwich ELISA, Double Antigen;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Human IFITM2(Interferon-induced transmembrane protein 2)ELISA Kit |
EH9300 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.156-10 ng/ml
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
ELISA kit for Human Interferon-induced transmembrane protein 3 |
EK2513 |
SAB |
96 tests |
EUR 670 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Interferon-induced transmembrane protein 3 in samples from serum, plasma, tissue homogenates and other biological fluids. |
ELISA kit for Human Interferon-induced 35 kDa protein |
EK2635 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Interferon-induced 35 kDa protein in samples from serum, plasma, tissue homogenates and other biological fluids. |
ELISA kit for Human Oncoprotein-induced transcript 3 protein |
EK3911 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Oncoprotein-induced transcript 3 protein in samples from serum, plasma, tissue homogenates and other biological fluids. |
ELISA kit for Human Interferon-induced transmembrane protein 10 |
EK4831 |
SAB |
96 tests |
EUR 603 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Interferon-induced transmembrane protein 10 in samples from serum, plasma, tissue homogenates and other biological fluids. |
Human IFI35/ Interferon-induced 35 kDa protein ELISA Kit |
E1212Hu |
Sunlong |
1 Kit |
EUR 605 |
Human IFITM10/ Interferon-induced transmembrane protein 10 ELISA Kit |
E1217Hu |
Sunlong |
1 Kit |
EUR 605 |
Human IFITM3/ Interferon-induced transmembrane protein 3 ELISA Kit |
E1218Hu |
Sunlong |
1 Kit |
EUR 605 |
Human OIT3/ Oncoprotein-induced transcript 3 protein ELISA Kit |
E1825Hu |
Sunlong |
1 Kit |
EUR 571 |
Human CXCL10(Interferon Gamma Induced Protein 10kDa) ELISA Kit |
EH0102 |
FN Test |
96T |
EUR 476.25 |
- Detection range: 7.813-500 pg/ml
- Uniprot ID: P02778
- Alias: CXCL10/IP-10/C7/IFI10/INP10/SCYB10/crg-2/gIP-10/mob-1
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 4.688pg/ml |
Human DEXI(Dexamethasone Precipitated Protein) ELISA Package