Human CCT2(Chaperonin Containing TCP1, Subunit 2) ELISA Package
Human Chaperonin Containing TCP1, Subunit 2 (CCT2) ELISA Kit |
RDR-CCT2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 589 |
Human Chaperonin Containing TCP1, Subunit 2 (CCT2) ELISA Kit |
RDR-CCT2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 820 |
Human Chaperonin Containing TCP1, Subunit 2 (CCT2) ELISA Kit |
RD-CCT2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 563 |
Human Chaperonin Containing TCP1, Subunit 2 (CCT2) ELISA Kit |
RD-CCT2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 783 |
Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) ELISA Kit |
DLR-CCT2-Mu-48T |
DL Develop |
48T |
EUR 566 |
- Should the Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) in samples from tissue homogenates or other biological fluids. |
Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) ELISA Kit |
DLR-CCT2-Mu-96T |
DL Develop |
96T |
EUR 741 |
- Should the Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) in samples from tissue homogenates or other biological fluids. |
Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) ELISA Kit |
RDR-CCT2-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 603 |
Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) ELISA Kit |
RDR-CCT2-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 840 |
Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) ELISA Kit |
RD-CCT2-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 577 |
Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) ELISA Kit |
RD-CCT2-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 802 |
Chaperonin Containing TCP1, Subunit 2 (CCT2) Antibody |
abx015792-100ul |
Abbexa |
100 ul |
EUR 411 |
- Shipped within 5-10 working days.
|
Chaperonin Containing TCP1, Subunit 2 (CCT2) Antibody |
20-abx175787 |
Abbexa |
|
|
|
Chaperonin Containing TCP1, Subunit 2 (CCT2) Antibody |
20-abx175788 |
Abbexa |
|
|
|
Chaperonin Containing TCP1, Subunit 2 (CCT2) Antibody |
20-abx128398 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1316.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Chaperonin Containing TCP1, Subunit 2 (CCT2) Antibody |
abx146184-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Chaperonin Containing TCP1, Subunit 2 (CCT2) Antibody |
20-abx171675 |
Abbexa |
|
|
|
Chaperonin Containing TCP1, Subunit 2 (CCT2) Antibody |
abx231396-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Recombinant Chaperonin Containing TCP1, Subunit 2 (CCT2) |
4-RPL292Hu01 |
Cloud-Clone |
-
EUR 494.24
-
EUR 235.00
-
EUR 1578.40
-
EUR 592.80
-
EUR 1085.60
-
EUR 394.00
-
EUR 3796.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P78371
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 56.4kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Chaperonin Containing TCP1, Subunit 2 expressed in: E.coli |
Human Chaperonin Containing TCP1, Subunit 2 (CCT2) ELISA Kit |
SEL292Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5189.65 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Chaperonin Containing TCP1, Subunit 2 (CCT2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inte
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Chaperonin Containing TCP1, Subunit 2 (CCT2) in Tissue homogenates, cell lysates and other biological fluids. |
Human Chaperonin Containing TCP1, Subunit 2 (CCT2) ELISA Kit |
SEL292Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 515.03 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Chaperonin Containing TCP1, Subunit 2 (CCT2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inte
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Chaperonin Containing TCP1, Subunit 2 (CCT2) in Tissue homogenates, cell lysates and other biological fluids. |
Human Chaperonin Containing TCP1, Subunit 2 (CCT2) ELISA Kit |
SEL292Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 692.9 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Chaperonin Containing TCP1, Subunit 2 (CCT2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inte
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Chaperonin Containing TCP1, Subunit 2 (CCT2) in Tissue homogenates, cell lysates and other biological fluids. |
Human Chaperonin Containing TCP1, Subunit 2 (CCT2) ELISA Kit |
SEL292Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2818.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Chaperonin Containing TCP1, Subunit 2 (CCT2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inte
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Chaperonin Containing TCP1, Subunit 2 (CCT2) in Tissue homogenates, cell lysates and other biological fluids. |
Human Chaperonin Containing TCP1, Subunit 2 (CCT2) ELISA Kit |
4-SEL292Hu |
Cloud-Clone |
-
EUR 5240.00
-
EUR 2769.00
-
EUR 693.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Chaperonin Containing TCP1, Subunit 2 elisa. Alternative names of the recognized antigen: CCT-beta
- CCTB
- TCP-1-beta
- T-Complex Protein 1 Subunit Beta
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Chaperonin Containing TCP1, Subunit 2 (CCT2) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Human Chaperonin Containing TCP1, Subunit 2 (CCT2) Protein |
20-abx167032 |
Abbexa |
-
EUR 690.00
-
EUR 286.00
-
EUR 2124.00
-
EUR 815.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) ELISA Kit |
SEL292Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5333.64 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inte
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) in Tissue homogenates and other biological fluids. |
Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) ELISA Kit |
SEL292Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 526.89 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inte
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) in Tissue homogenates and other biological fluids. |
Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) ELISA Kit |
SEL292Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 709.84 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inte
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) in Tissue homogenates and other biological fluids. |
Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) ELISA Kit |
SEL292Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2894.28 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inte
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) in Tissue homogenates and other biological fluids. |
Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) ELISA Kit |
4-SEL292Mu |
Cloud-Clone |
-
EUR 5384.00
-
EUR 2845.00
-
EUR 710.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Chaperonin Containing TCP1, Subunit 2 elisa. Alternative names of the recognized antigen: CCT-beta
- CCTB
- TCP-1-beta
- T-Complex Protein 1 Subunit Beta
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Human Chaperonin Containing TCP1, Subunit 2 (CCT2) CLIA Kit |
20-abx495908 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Human CCT2 (Chaperonin Containing TCP1, Subunit 2) |
ELK6962 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Chaperonin Containing TCP1, Subunit 2 (CCT2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody s
- Show more
|
Description: A sandwich ELISA kit for detection of Chaperonin Containing TCP1, Subunit 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) Protein |
20-abx652852 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) Protein |
20-abx652853 |
Abbexa |
-
EUR 718.00
-
EUR 286.00
-
EUR 2221.00
-
EUR 857.00
-
EUR 509.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) CLIA Kit |
20-abx495909 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Mouse CCT2 (Chaperonin Containing TCP1, Subunit 2) |
ELK8023 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Chaperonin Containing TCP1, Subunit 2 (CCT2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody s
- Show more
|
Description: A sandwich ELISA kit for detection of Chaperonin Containing TCP1, Subunit 2 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Chaperonin Containing TCP1, Subunit 2 (CCT2) Polyclonal Antibody (Human, Mouse) |
4-PAL292Hu01 |
Cloud-Clone |
-
EUR 262.00
-
EUR 2747.00
-
EUR 679.00
-
EUR 331.00
-
EUR 220.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CCT2 (Met1~Cys488)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2) |
Chaperonin Containing TCP1, Subunit 2 (CCT2) Polyclonal Antibody (Human, Mouse), APC |
4-PAL292Hu01-APC |
Cloud-Clone |
-
EUR 368.00
-
EUR 3599.00
-
EUR 993.00
-
EUR 472.00
-
EUR 229.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CCT2 (Met1~Cys488)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2). This antibody is labeled with APC. |
Chaperonin Containing TCP1, Subunit 2 (CCT2) Polyclonal Antibody (Human, Mouse), Biotinylated |
4-PAL292Hu01-Biotin |
Cloud-Clone |
-
EUR 328.00
-
EUR 2697.00
-
EUR 786.00
-
EUR 404.00
-
EUR 226.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CCT2 (Met1~Cys488)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2). This antibody is labeled with Biotin. |
Chaperonin Containing TCP1, Subunit 2 (CCT2) Polyclonal Antibody (Human, Mouse), Cy3 |
4-PAL292Hu01-Cy3 |
Cloud-Clone |
-
EUR 449.00
-
EUR 4757.00
-
EUR 1283.00
-
EUR 588.00
-
EUR 264.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CCT2 (Met1~Cys488)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2). This antibody is labeled with Cy3. |
Chaperonin Containing TCP1, Subunit 2 (CCT2) Polyclonal Antibody (Human, Mouse), FITC |
4-PAL292Hu01-FITC |
Cloud-Clone |
-
EUR 314.00
-
EUR 2899.00
-
EUR 814.00
-
EUR 397.00
-
EUR 203.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CCT2 (Met1~Cys488)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2). This antibody is labeled with FITC. |
Chaperonin Containing TCP1, Subunit 2 (CCT2) Polyclonal Antibody (Human, Mouse), HRP |
4-PAL292Hu01-HRP |
Cloud-Clone |
-
EUR 335.00
-
EUR 3135.00
-
EUR 877.00
-
EUR 426.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CCT2 (Met1~Cys488)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2). This antibody is labeled with HRP. |
Chaperonin Containing TCP1, Subunit 2 (CCT2) Polyclonal Antibody (Human, Mouse), PE |
4-PAL292Hu01-PE |
Cloud-Clone |
-
EUR 314.00
-
EUR 2899.00
-
EUR 814.00
-
EUR 397.00
-
EUR 203.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CCT2 (Met1~Cys488)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2). This antibody is labeled with PE. |
Chaperonin Containing TCP1, Subunit 2 (CCT2) Polyclonal Antibody (Human, Mouse), APC-Cy7 |
4-PAL292Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 616.00
-
EUR 7078.00
-
EUR 1867.00
-
EUR 824.00
-
EUR 338.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CCT2 (Met1~Cys488)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Chaperonin Containing TCP1, Subunit 2 (CCT2). This antibody is labeled with APC-Cy7. |
Chaperonin Containing TCP1, Subunit 3 (CCT3) Antibody |
20-abx111563 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Chaperonin Containing TCP1, Subunit 4 (CCT4) Antibody |
20-abx111564 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Chaperonin Containing TCP1, Subunit 5 (CCT5) Antibody |
20-abx111565 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Chaperonin Containing TCP1, Subunit 6A (CCT6A) Antibody |
20-abx111566 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Chaperonin Containing TCP1, Subunit 6B (CCT6B) Antibody |
20-abx111567 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Chaperonin Containing TCP1, Subunit 7 (CCT7) Antibody |
20-abx111568 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Chaperonin Containing TCP1, Subunit 8 (CCT8) Antibody |
20-abx111569 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Chaperonin Containing TCP1, Subunit 6B (CCT6B) Antibody |
abx146187-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Chaperonin Containing TCP1, Subunit 4 (CCT4) Antibody |
abx146193-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Chaperonin Containing TCP1, Subunit 3 (CCT3) Antibody |
abx146205-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Chaperonin Containing TCP1, Subunit 7 (CCT7) Antibody |
abx146230-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Chaperonin Containing TCP1, Subunit 7 (CCT7) Antibody |
abx413783-01mg |
Abbexa |
0.1 mg |
EUR 495 |
|
Chaperonin Containing TCP1, Subunit 6A (CCT6A) Antibody |
abx330610-100ul |
Abbexa |
100 ul |
EUR 425 |
- Shipped within 5-10 working days.
|
Chaperonin Containing TCP1, Subunit 8 (CCT8) Antibody |
20-abx325666 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Chaperonin Containing TCP1, Subunit 6A (CCT6A) Antibody |
20-abx328411 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Chaperonin Containing TCP1, Subunit 3 (CCT3) Antibody |
abx430056-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Chaperonin Containing TCP1, Subunit 6B (CCT6B) Antibody |
20-abx301582 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Chaperonin Containing TCP1, Subunit 3 (CCT3) Antibody |
abx231397-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Chaperonin Containing TCP1, Subunit 3 (CCT3) Antibody |
abx231398-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Chaperonin Containing TCP1, Subunit 6B (CCT6B) Antibody |
abx231402-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Chaperonin Containing TCP1, Subunit 7 (CCT7) Antibody |
abx231403-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Chaperonin Containing TCP1, Subunit 6B (CCT6B) Antibody (HRP) |
20-abx309773 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Chaperonin Containing TCP1, Subunit 6B (CCT6B) Antibody (FITC) |
20-abx309774 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Chaperonin Containing TCP1, Subunit 6B (CCT6B) Antibody (Biotin) |
20-abx309775 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Anti-TCP1 beta/CCT2 Antibody |
PB9992 |
BosterBio |
100ug/vial |
EUR 334 |
Anti-TCP1 eta/CCT7 Antibody |
A08169-2 |
BosterBio |
100ug/vial |
EUR 294 |
CCT2 ELISA Kit (Human) (OKCD00604) |
OKCD00604 |
Aviva Systems Biology |
96 Wells |
EUR 909 |
Description: Description of target: Molecular chaperone; assists the folding of proteins upon ATP hydrolysis. As part of the BBS/CCT complex may play a role in the assembly of BBSome, a complex involved in ciliogenesis regulating transports vesicles to the cilia. Known to play a role, in vitro, in the folding of actin and tubulin.1 Publication
<p>Manually curated information for which there is published experimental evidence.</p>
<p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.17"BBS6, BBS10, and BBS12 form a complex with CCT/TRiC family chaperonins and mediate BBSome assembly."_x005F_x005F_x000D_Seo S., Baye L.M., Schulz N.P., Beck J.S., Zhang Q., Slusarski D.C., Sheffield V.C._x005F_x005F_x000D_Proc. Natl. Acad. Sci. U.S.A. 107:1488-1493(2010) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, SUBCELLULAR LOCATION, IDENTIFICATION IN BBS/CCT COMPLEX. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.056 ng/mL |
CCT2 ELISA Kit (Human) (OKDD00174) |
OKDD00174 |
Aviva Systems Biology |
96 Wells |
EUR 1053 |
Description: Description of target: The protein encoded by this gene is a molecular chaperone that is a member of the chaperonin containing TCP1 complex (CCT), also known as the TCP1 ring complex (TRiC). This complex consists of two identical stacked rings, each containing eight different proteins. Unfolded polypeptides enter the central cavity of the complex and are folded in an ATP-dependent manner. The complex folds various proteins, including actin and tubulin. Two transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.067 ng/mL |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Human T-Complex Protein 1 Subunit Beta (CCT2) ELISA Kit |
20-abx150988 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human T- complex protein 1 subunit beta, CCT2 ELISA KIT |
ELI-13747h |
Lifescience Market |
96 Tests |
EUR 824 |
Human T- complex protein 1 subunit alpha, TCP1 ELISA KIT |
ELI-17403h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Chaperonin 10 ELISA kit |
E01C0815-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Chaperonin 10 ELISA kit |
E01C0815-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Chaperonin 10 ELISA kit |
E01C0815-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse T-Complex Protein 1 Subunit Beta (CCT2) ELISA Kit |
20-abx153795 |
Abbexa |
-
EUR 7504.00
-
EUR 3996.00
-
EUR 926.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Bovine T- complex protein 1 subunit beta, CCT2 ELISA KIT |
ELI-18861b |
Lifescience Market |
96 Tests |
EUR 928 |
Mouse T- complex protein 1 subunit beta, Cct2 ELISA KIT |
ELI-41400m |
Lifescience Market |
96 Tests |
EUR 865 |
Human T-complex protein 1 subunit beta (CCT2) |
1-CSB-EP004856HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 73.4 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human T-complex protein 1 subunit beta(CCT2) expressed in E.coli |
Human T-complex protein 1 subunit beta (CCT2) |
1-CSB-YP004856HU |
Cusabio |
-
EUR 430.00
-
EUR 234.00
-
EUR 1508.00
-
EUR 642.00
-
EUR 1009.00
-
EUR 291.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 59.4 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human T-complex protein 1 subunit beta(CCT2) expressed in Yeast |
CCT2 ELISA Kit (Mouse) (OKDD00818) |
OKDD00818 |
Aviva Systems Biology |
96 Wells |
EUR 1079 |
Description: Description of target: Molecular chaperone, assists the folding of proteins upon atp hydrolysis. as part of the bbs/cct complex may play a role in the assembly of bbsome, a complex involved in ciliogenesis regulating transports vesicles to the cilia. known to play a role, in vitro, in the folding of actin and tubulin (by similarity).;Species reactivity: Mouse;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.058ng/mL |
Human chaperonin 10,CPN10 ELISA Kit |
201-12-0674 |
SunredBio |
96 tests |
EUR 440 |
- This chaperonin 10 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human chaperonin 10,CPN10 ELISA kit |
E01C2306-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human chaperonin 10,CPN10 ELISA kit |
E01C2306-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human chaperonin 10,CPN10 ELISA kit |
E01C2306-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Chaperonin 10 (CPN10) ELISA Kit |
abx052001-96tests |
Abbexa |
96 tests |
EUR 786 |
- Shipped within 5-12 working days.
|
Human chaperonin 10,CPN10 ELISA Kit |
CN-03950H1 |
ChemNorm |
96T |
EUR 464 |
Human chaperonin 10,CPN10 ELISA Kit |
CN-03950H2 |
ChemNorm |
48T |
EUR 313 |
Human chaperonin 10, CPN10 ELISA Kit |
CSB-E09917h-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human chaperonin 10, CPN10 in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human chaperonin 10, CPN10 ELISA Kit |
1-CSB-E09917h |
Cusabio |
-
EUR 900.00
-
EUR 5476.00
-
EUR 2900.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human chaperonin 10, CPN10 in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Chaperonin 10 (CPN10) ELISA Kit |
abx351409-96tests |
Abbexa |
96 tests |
EUR 786 |
- Shipped within 5-12 working days.
|
Human chaperonin 10(CPN10)ELISA Kit |
GA-E0690HM-48T |
GenAsia Biotech |
48T |
EUR 289 |
Human chaperonin 10(CPN10)ELISA Kit |
GA-E0690HM-96T |
GenAsia Biotech |
96T |
EUR 466 |
Bovine T- complex protein 1 subunit alpha, TCP1 ELISA KIT |
ELI-41835b |
Lifescience Market |
96 Tests |
EUR 928 |
Mouse T- complex protein 1 subunit alpha, Tcp1 ELISA KIT |
ELI-41836m |
Lifescience Market |
96 Tests |
EUR 865 |
Goat Chaperonin 10 ELISA kit |
E06C0815-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Chaperonin 10 ELISA kit |
E06C0815-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Chaperonin 10 ELISA kit |
E06C0815-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Chaperonin 10 ELISA kit |
E03C0815-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Chaperonin 10 ELISA kit |
E03C0815-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Chaperonin 10 ELISA kit |
E03C0815-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Chaperonin 10 ELISA kit |
E04C0815-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Chaperonin 10 ELISA kit |
E04C0815-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Chaperonin 10 ELISA kit |
E04C0815-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Chaperonin 10 ELISA kit |
E02C0815-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Chaperonin 10 ELISA kit |
E02C0815-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Chaperonin 10 ELISA kit |
E02C0815-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Chaperonin 10 ELISA kit |
E09C0815-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Chaperonin 10 ELISA kit |
E09C0815-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Chaperonin 10 ELISA kit |
E09C0815-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Chaperonin 10 ELISA kit |
E08C0815-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Chaperonin 10 ELISA kit |
E08C0815-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Chaperonin 10 ELISA kit |
E08C0815-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Chaperonin 10 ELISA kit |
E07C0815-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Chaperonin 10 ELISA kit |
E07C0815-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Chaperonin 10 ELISA kit |
E07C0815-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
CCT2 antibody |
38998-100ul |
SAB |
100ul |
EUR 252 |
CCT2 Antibody |
43067-100ul |
SAB |
100ul |
EUR 252 |
CCT2 Antibody |
1-CSB-PA004856ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against CCT2. Recognizes CCT2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IP; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IP:1:200-1:2000 |
CCT2 Antibody |
BF0056 |
Affbiotech |
200ul |
EUR 376 |
Description: CCT2 antibody detects endogenous levels of total CCT2. |
CCT2 siRNA |
20-abx900891 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CCT2 siRNA |
20-abx910899 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CCT2 siRNA |
20-abx910900 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ELISA kit for Human CPN10 (Chaperonin 10) |
E-EL-H0697 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's CPN10 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human CPN10. Standards or samples are added to the micro ELISA plate wells and combined with
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human CPN10 (Chaperonin 10) in samples from Serum, Plasma, Cell supernatant |
Human T-Complex 1 (TCP1) ELISA Kit |
20-abx383676 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-12 working days.
|
AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS |
AP-STR-KIT-2 |
CORNING |
1/pk |
EUR 367 |
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller |
T-Complex Protein 1 Subunit Beta (CCT2) Antibody |
20-abx005024 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
T-Complex Protein 1 Subunit Beta (CCT2) Antibody |
abx011837-100ul |
Abbexa |
100 ul |
EUR 411 |
- Shipped within 5-10 working days.
|
T-Complex Protein 1 Subunit Beta (CCT2) Antibody |
20-abx321387 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
T-Complex Protein 1 Subunit Beta (CCT2) Antibody |
20-abx225083 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
CCT2 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0396403 |
ABM |
1.0 ug DNA |
EUR 154 |
Human CCT2 shRNA Plasmid |
20-abx957196 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
CCT2 Recombinant Protein (Human) |
RP037867 |
ABM |
100 ug |
Ask for price |
CCT2 Recombinant Protein (Human) |
RP037870 |
ABM |
100 ug |
Ask for price |
Rat chaperonin 10,CPN10 ELISA kit |
E02C2306-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat chaperonin 10,CPN10 ELISA kit |
E02C2306-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat chaperonin 10,CPN10 ELISA kit |
E02C2306-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Chaperonin 10 ELISA kit |
E05C0815-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Chaperonin 10 ELISA kit |
E05C0815-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Chaperonin 10 ELISA kit |
E05C0815-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Chaperonin 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse chaperonin 10,CPN10 ELISA kit |
E03C2306-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse chaperonin 10,CPN10 ELISA kit |
E03C2306-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse chaperonin 10,CPN10 ELISA kit |
E03C2306-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat chaperonin 10,CPN10 ELISA kit |
E06C2306-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat chaperonin 10,CPN10 ELISA kit |
E06C2306-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat chaperonin 10,CPN10 ELISA kit |
E06C2306-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit chaperonin 10,CPN10 ELISA kit |
E04C2306-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit chaperonin 10,CPN10 ELISA kit |
E04C2306-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit chaperonin 10,CPN10 ELISA kit |
E04C2306-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey chaperonin 10,CPN10 ELISA kit |
E09C2306-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey chaperonin 10,CPN10 ELISA kit |
E09C2306-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey chaperonin 10,CPN10 ELISA kit |
E09C2306-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog chaperonin 10,CPN10 ELISA kit |
E08C2306-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog chaperonin 10,CPN10 ELISA kit |
E08C2306-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog chaperonin 10,CPN10 ELISA kit |
E08C2306-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig chaperonin 10,CPN10 ELISA kit |
E07C2306-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig chaperonin 10,CPN10 ELISA kit |
E07C2306-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig chaperonin 10,CPN10 ELISA kit |
E07C2306-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine chaperonin 10,CPN10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Chaperonin 10 (CPN10) ELISA Kit |
abx359786-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Pig Chaperonin 10 (CPN10) ELISA Kit |
abx361563-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Chicken Chaperonin 10 (CPN10) ELISA Kit |
abx357010-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Rabbit Chaperonin 10 (CPN10) ELISA Kit |
abx363426-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Sheep Chaperonin 10 (CPN10) ELISA Kit |
abx364720-96tests |
Abbexa |
96 tests |
EUR 926 |
- Shipped within 5-12 working days.
|
TCP1 antibody |
70R-20745 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal TCP1 antibody |
TCP1 Antibody |
32517-100ul |
SAB |
100ul |
EUR 252 |
TCP1 Antibody |
43013-100ul |
SAB |
100ul |
EUR 252 |
TCP1 Antibody |
1-CSB-PA050225 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against TCP1. Recognizes TCP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000 |
TCP1 Antibody |
DF6714 |
Affbiotech |
200ul |
EUR 304 |
Description: TCP1 Antibody detects endogenous levels of total TCP1. |
TCP1 Antibody |
1-CSB-PA023320GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against TCP1. Recognizes TCP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
TCP1 Antibody |
1-CSB-PA023320LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TCP1. Recognizes TCP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:500-1:1000, IF:1:200-1:500 |
TCP1 siRNA |
20-abx905504 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TCP1 siRNA |
20-abx936380 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TCP1 siRNA |
20-abx936381 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TCP1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2351303 |
ABM |
1.0 ug DNA |
EUR 154 |
CCT2 Conjugated Antibody |
C43067 |
SAB |
100ul |
EUR 397 |
CCT2 Conjugated Antibody |
C38998 |
SAB |
100ul |
EUR 397 |
CCT2 Blocking Peptide |
BF0056-BP |
Affbiotech |
1mg |
EUR 195 |
CCT2 cloning plasmid |
CSB-CL004856HU1-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1608
- Sequence: atggcgtccctttcccttgcacctgttaacatctttaaggcaggagctgatgaagagagagcagagacagctcgtctgacttcttttattggtgccatcgccattggagacttggtaaagagcaccttgggacccaaaggcatggacaaaattcttctaagcagtggacgagatg
- Show more
|
Description: A cloning plasmid for the CCT2 gene. |
CCT2 cloning plasmid |
CSB-CL004856HU2-10ug |
Cusabio |
10ug |
EUR 560 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1608
- Sequence: atggcgtccctttcccttgcacctgttaacatctttaaggcaggagctgatgaagagagagcagagacagctcgtctgacttcttttattggtgccatcgccattggagacttggtaaagagcaccttgggacccaaaggcatggacaaaattcttctaagcagtggacgagatg
- Show more
|
Description: A cloning plasmid for the CCT2 gene. |
CCT2 Rabbit pAb |
A6546-100ul |
Abclonal |
100 ul |
EUR 308 |
CCT2 Rabbit pAb |
A6546-200ul |
Abclonal |
200 ul |
EUR 459 |
CCT2 Rabbit pAb |
A6546-20ul |
Abclonal |
20 ul |
EUR 183 |
CCT2 Rabbit pAb |
A6546-50ul |
Abclonal |
50 ul |
EUR 223 |
anti- CCT2 antibody |
FNab01396 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: chaperonin containing TCP1, subunit 2(beta)
- Uniprot ID: P78371
- Gene ID: 10576
- Research Area: Metabolism
|
Description: Antibody raised against CCT2 |
anti-CCT2 (5B5F5) |
LF-MA30629 |
Abfrontier |
100 ul |
EUR 527 |
Description: Mouse Monoclonal to CCT2 |
anti-CCT2 (5B5C4) |
LF-MA30637 |
Abfrontier |
100 ul |
EUR 527 |
Description: Mouse Monoclonal to CCT2 |
Human CCT2(Chaperonin Containing TCP1, Subunit 2) ELISA Package